Please wait a moment until all data is loaded. This message will disappear when all data is loaded.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
5-aminolevulinic acid synthase + H2O
?
-
-
-
?
Abnormal puromucyl peptides + H2O
?
-
not in vitro
-
-
?
Abz-QLRSLNGEWRFAWFPAPEAV[Tyr(3-NO2)]A + H2O
?
acid resistance regulator GdE protein + H2O
?
-
degradation of GadE protein by Lon rapidly terminates the acid resistance response upon shift back to neutral pH and avoids overexpression of acid resistance genes in stationary phases
-
-
?
acyl-CoA oxidase + H2O
?
-
exhibits little, if any, in vitro acyl-CoA oxidase processing activity
-
-
?
Ald4 + H2O
?
-
i.e. potassium-activated aldehyde dehydrogenase, displays an oxidation index greater than 1 and accumulates in mitochondria lacking pim1 activity
-
-
?
alpha-casein-fluorescein isothiocyanate + H2O
?
-
-
-
?
alpha-methyl casein + H2O
?
-
-
-
?
ATP + H2O
phosphate + ADP
Atp2 + H2O
?
-
i.e. F1F0-ATP synthase subunit beta, displays an oxidation index greater than 1 and accumulates in mitochondria lacking pim1 activity
-
-
?
bacteriophage lambda N protein + H2O
?
-
-
-
-
?
Bacteriophage lambda N-protein + H2O
?
-
-
-
-
?
Bacteriophage lambda protein N + H2O
Hydrolyzed bacteriophage lambda protein N
beta-galactosidase + H2O
?
-
-
-
?
beta-galactosidase fragment 3-93 + H2O
?
-
a 48-residue N-terminal variant and a 33-residue C-terminal variant of beta-galactosidase fragment are degraded very slowly. Lon rapidly degrades a variant containing the 68 N-terminal residues and a variant containing the C-terminal 43 residues of the 3-93 fragment. Residues 49-68, QLRSLNGEWRFAWFPAPEAV play an important role in regocnition by Lon
-
-
?
beta-galactosidase-93-titinI27 + H2O
?
-
-
-
-
?
bovine apocytochrome P450scc + H2O
?
-
-
-
?
Canavanine-containing proteins + H2O
?
-
not in vitro
-
-
?
casein + H2O
hydrolyzed casein
CNBr-fragments of bovine serum albumin + H2O
?
-
less dependent on ATP hydrolysis
-
-
?
CspD + H2O
?
-
CspD is a replication inhibitor, which is induced in stationary phase or upon carbon starvation and increases the production of persister cells. CspD is subject to proteolysis by the Lon protease both in vivo and in vitro. Turnover of CspD by Lon is strictly adjusted to the growth rate and growth phase of Escherichia coli, reflecting the necessity to control CspD levels according to the physiological conditions. Truncation or point mutation of CspD does not elevate protein stability
-
-
?
CysB + H2O
?
a positive cysDNC operon transcription regulator
-
-
?
CysD + H2O
?
a subunit of the sulfate adenylyltransferase, low activity
-
-
?
cystathionine beta-synthase + H2O
?
when misfolded or unfolded
-
-
?
cytochrome c oxidase 4 isoform 1 + H2O
?
i.e. COX4-1
-
-
?
cytochrome c oxidase subunit + H2O
?
cytochrome c oxidase subunit IVi1 + H2O
?
cytochrome c oxidase subunit Vb + H2O
?
Denatured albumin + H2O
?
-
-
-
-
?
Denatured bovine serum albumin + H2O
?
-
-
-
-
?
Denatured immunoglobulin G + H2O
?
-
-
-
-
?
Denatured lambda Cro protein + H2O
?
-
poor substrate, inhibits casein hydrolysis
-
-
?
DNA methyltransferase + H2O
?
-
selectively degrades cell-cycle-regulated DNA methyltransferase thereby regulating methylation of chromosomal DNA and cellular differentiation
-
-
?
DNA-binding protein HUbeta + H2O
?
-
Lon binds to both histone-like proteins HUalpha and HUbeta, but selectively degrades only HUbeta in the presence of ATP. Preferred cleavage site is the A20-A21, followed in preference by L36-K37. Degradation of substrate mutants A20D and A20Q is more slowly. Mechanism follows at least three stages: binding of Lon with the HU protein, hydrolysis of ATP by Lon to provide energy to loosen the binding to the HU protein and to allow an induced-fit conformational change, and specific cleavage of only HUbeta
-
-
?
EYLFRHSDNELLHWM + H2O
?
-
degraded at rates within 50% of the F-QLRSLNGEWRFAWFPAPEAV-Q peptide
-
-
?
F-QLRSLNGEWRFAWFPAPEAV-Q + H2O
F-QLRSLNG + EWRFAWFPAPEAV-Q
-
residues 4968 of betqa-galactosidase flanked by a fluorophore-quencher pair
-
-
?
FAKYWQAFRQYPRLQ + H2O
?
-
degraded considerably faster than the F-QLRSLNGEWRFAWFPAPEAV-Q peptide
-
-
?
FITC-casein + H2O
?
-
-
-
-
?
fluorogenic peptide S3 + H2O
?
-
-
-
?
Fluorogenic peptides + H2O
?
-
-
-
-
?
FRETN 89-98 + H2O
?
-
-
-
?
FRETN 89-98Abu + H2O
?
-
peptide-based substrate containing the Y(NO2)-Abz internal fluorescence quenching pair and peptide sequence RGIT-Abu-SGRQK, no substrate for human protease ClpXP
-
-
?
FRQYPRLQGGFVWDW + H2O
?
-
degraded at rates within 30% of the F-QLRSLNGEWRFAWFPAPEAV-Q peptide
-
-
?
FVWDWVDQSLIKYDE + H2O
?
-
very slow degradation
-
-
?
GFP-titinI27-sul20C + H2O
?
-
when degradation initiated at the N-terminus, the full-length substrate disappears about 10fold more rapidly than when degradation initiated at the C-terminus
-
-
?
Gln-Ala-Ala-Phe-p-nitroanilide + H2O
?
-
preferred substrate
-
?
Glu-Ala-Ala-Phe-4-methoxy-2-naphthylamide + H2O
Glu-Ala-Ala-Phe + 4-methoxy-2-naphthylamine
-
-
-
?
Glucagon + H2O
Hydrolyzed glucagon
glutaminase C + H2O
?
when misfolded or unfolded
-
-
?
glutaryl-AAF-4-methoxy-beta-naphthylamide + H2O
glutaryl-L-Ala-L-Ala-L-Phe + 4-methoxy-2-naphthylamine
Glutaryl-Ala-Ala-Ala-methoxynaphthylamide + H2O
Glutaryl-Ala-Ala-Ala + methoxynaphthylamine
glutaryl-Ala-Ala-Phe-4-methoxy-beta-naphthylamide + H2O
?
Glutaryl-Ala-Ala-Phe-methoxynaphthylamide + H2O
Glutaryl-Ala-Ala-Phe + methoxynaphthylamine
Glutaryl-Gly-Gly-Pro-methoxynaphthylamide + H2O
Glutaryl-Gly-Gly-Pro + methoxynaphthylamine
GlyA + H2O
?
a protein of the MetR regulon
-
-
?
heat shock sigma factor 32 + H2O
?
-
degraded by synergistic action of lon, Clp and HflB
-
-
?
HemA + H2O
?
-
conditional proteolysis mediated by lon and ClpAP
-
-
?
hemoglobin A + H2O
?
can degrade unfolded human hemoglobin A at 70°C either in presence or absence of ATP, at 37°C only in presence of ATP
-
?
homoserine trans-succinylase + H2O
?
-
degraded by synergistic action of lon, ClpYQ, ClpXP and/or ClpAP
-
-
?
HQWRGDFQFNISRYS + H2O
?
-
degraded at rates within 30% of the F-QLRSLNGEWRFAWFPAPEAV-Q peptide
-
-
?
HSP60 + H2O
?
-
i.e. heat shock protein 60, displays an oxidation index greater than 1 and accumulates in mitochondria lacking pim1 activity
-
-
?
human alphaA-crystallin + H2O
?
-
Lon recognizes conserved determinants in the folded alpha-crystallin domain itself
-
-
?
human alphaB-crystallin + H2O
?
-
Lon recognizes conserved determinants in the folded alpha-crystallin domain itself
-
-
?
human titin + H2O
?
-
-
-
-
?
hydroxyacyl-coenzyme A dehydrogenase + H2O
?
-
-
-
-
?
HYPNHPLWYTLCDRY + H2O
?
-
degraded at rates within 50% of the F-QLRSLNGEWRFAWFPAPEAV-Q peptide
-
-
?
IbpB + H2O
?
-
i.e. Escherichia coli small heat shock protein B. Lon degrades purified IbpA substantially more slowly than purified IbpB, which is a consequence of differences in maximal Lon degradation rates and not in substrate affinity.The variable N- and C-terminal tails of the Ibps contain critical determinants that control the maximal rate of Lon degradation
-
-
?
Ilv5 + H2O
?
-
i.e. ketol acid reductoisomerase, displays an oxidation index greater than 1 and accumulates in mitochondria lacking pim1 activity
-
-
?
lambda phage DNA + H2O
?
-
-
-
?
lambda phage N protein + H2O
?
LLIRGVNRHEHHPLH + H2O
?
-
degraded at rates within 50% of the F-QLRSLNGEWRFAWFPAPEAV-Q peptide
-
-
?
Lpd1 + H2O
?
-
i.e. dihydrolipoamide dehydrogenase E3 component of pyruvate dehydrogenase complex, displays an oxidation index greater than 1 and accumulates in mitochondria lacking pim1 activity
-
-
?
LRAGENRLAVMVLRW + H2O
?
-
degraded at rates within 50% of the F-QLRSLNGEWRFAWFPAPEAV-Q peptide
-
-
?
LTEAKHQQQFFQFRL + H2O
?
-
degraded at rates within 50% of the F-QLRSLNGEWRFAWFPAPEAV-Q peptide
-
-
?
maltose-binding protein-SulA + H2O
?
-
-
-
-
?
MazE antitoxin + H2O
?
-
-
-
-
?
misfolded protein + H2O
?
mitochondrial aconitase + H2O
?
mitochondrial processing peptidase alpha subunit + H2O
?
mitochondrial processing peptidase alpha-subunit + H2O
?
-
-
-
-
?
mitochondrial transcription factor A + H2O
?
i.e. TFAM
-
-
?
Mrp20 + H2O
?
-
i.e. mitochondrial subunit of the large ribosomal particle, displays an oxidation index greater than 1 and accumulates in mitochondria lacking pim1 activity
-
-
?
Mutant form of alkaline phosphatase PhoA61 + H2O
?
-
not in vitro
-
-
?
MWRMSGIFRDVSLLH + H2O
?
-
degraded at rates within 50% of the F-QLRSLNGEWRFAWFPAPEAV-Q peptide
-
-
?
N-glutaryl-alanylalanylphenylalanyl-3-methoxynaphthylamide + H2O
?
-
fluorogenic petide
-
?
N-succinyl-LLVY-7-amido-4-methylcoumarin + H2O
N-succinyl-L-leucyl-L-leucine + Val-Tyr-7-amido-4-methylcoumarin + N-succinyl-L-leucine + Leu-Val-Tyr-7-amido-4-methylcoumarin
-
no cleavage of bond between Y and 7-amido-4-methylcoumarin
-
-
?
native aconitase + H2O
?
-
degradation at a lower efficiency than oxidized aconitase
-
-
?
oxidized aconitase + H2O
?
-
oxidatively modified proteins and unfolded peptides are good substrates for proteolysis by lon
-
-
?
Oxidized insulin B-chain + H2O
Hydrolyzed insulin B-chain
Pancreatic polypeptide + H2O
?
-
-
-
-
?
Parathyroid hormone + H2O
?
-
-
-
-
?
Pdb1 + H2O
?
-
i.e. pyruvate dehydrogenase E1component subunit beta, displays an oxidation index greater than 1 and accumulates in mitochondria lacking pim1 activity
-
-
?
polymerase gamma + H2O
?
-
-
-
-
?
PR65/A-ssrA + H2O
?
ssrA-fusion protein
-
-
?
Pro-His-Pro-Phe-His-Leu-Leu-Val-Tyr + H2O
?
-
nonapeptide related to equine angiotensinogen
-
-
?
Proteins with highly abnormal conformation + H2O
?
PTS1 protein + H2O
?
-
-
-
-
?
QLRSLNGEWRFAWFPAPEAV + H2O
QLRSLNG + EWRFAWFPAPEAV
-
variant of the I27 domain of human titin containing aspartic acids in place of both wild-type cysteines and fused with residues 49-68 of beta-galactosidase fragment 3-93
-
-
?
RelB antitoxin + H2O
?
-
-
-
-
?
ribosomal L13 protein + H2O
?
-
-
-
-
?
ribosomal L9 protein + H2O
?
-
-
-
-
?
ribosomal S2 protein + H2O
?
ribulose-1,5-bisphosphate carboxylase/oxygenase + H2O
?
RubiscoTK
-
?
RMVQRDRNHPSVIIW + H2O
?
-
degraded at rates within 50% of the F-QLRSLNGEWRFAWFPAPEAV-Q peptide
-
-
?
RNA
?
-
mitochondrial lon binds preferentially to single-stranded RNA in a sequence-dependent manner
-
-
?
RWDLPLSDMYTPYVF + H2O
?
-
degraded at rates within 50% of the F-QLRSLNGEWRFAWFPAPEAV-Q peptide
-
-
?
RWLPAMSERVTRMVQ + H2O
?
-
degraded at rates within 50% of the F-QLRSLNGEWRFAWFPAPEAV-Q peptide
-
-
?
RWQFNRQSGFLSQMW + H2O
?
-
degraded considerably faster than the F-QLRSLNGEWRFAWFPAPEAV-Q peptide
-
-
?
S1 peptide + H2O
?
-
decapeptide S1 containing the amino acid residues 89-98 of the bacteriophage lambdaN transcription anti-termination factor, and a fluorescence donor-acceptor pair
-
-
?
sigma factor G + H2O
?
-
lonA
-
-
?
sigma factor H + H2O
?
-
lonA
-
-
?
SMC protein + H2O
?
-
lonA
-
-
?
Sod2 + H2O
?
-
i.e. mitochondrial superoxide dismutase, displays an oxidation index greater than 1 and accumulates in mitochondria lacking pim1 activity
-
-
?
steroidogenic acute regulatory protein + H2O
?
Suc-Phe-Leu-Phe-SBzl + H2O
?
-
a N-substituted tripeptide substrate
-
-
?
Succinyl-Ala-Ala-Phe-methoxynaphthylamide + H2O
Succinyl-Ala-Ala-Phe + methoxynaphthylamine
succinyl-FLF-4-methoxy-beta-naphthylamide + H2O
succinyl-FLF + 4-methoxy-beta-naphthylamine
Succinyl-Phe-Ala-Phe-methoxynaphthylamide + H2O
Succinyl-Phe-Ala-Phe + methoxynaphthylamine
succinyl-Phe-Leu-Phe-4-methoxy-beta-naphthylamide + H2O
?
ThiS-YbeA + H2O
?
YbeA is a alpha/beta-knot methyltransferase from Escherichia coli and a deeply 31-knotted protein. Knotted fusion protein ThiS-YbeA is degraded by ClpXP. Process modeling, overview
-
-
?
ThiS-YbeA-ssrA + H2O
?
low activity, process modeling, overview
-
-
?
titin-I27CD + H2O
?
-
variant of the I27 domain of human titin containing aspartic acids in place of both wild-type cysteines
-
-
?
titinI27-beta-galactosidase-93 + H2O
?
-
-
-
-
?
titinI27-beta-galactosidase-93-titinI27 + H2O
?
-
-
-
-
?
tmRNA-tagged protein + H2O
?
transcription activator SoxS + H2O
?
-
fusion of the C-terminal domain of Rob, which is a transcription activator of the SoxRS/MarA/Rob regulon, to SoxS protects its N-terminus from Lon protease, as Lon's normally rapid degradation of SoxS is blocked in the chimera
-
-
?
UCH-L1-ssrA + H2O
?
ssrA-fusion protein, UCH-L1 is a 52-knotted protein, high activity. In degradation of UCH-L1-ssrA, the degron is located at the C-terminus of the knotted protein. C-terminally tagged UCH-L1-ssrA is not noticeably degraded by ClpXP, while N-terminally tagged ssrA-x-UCH-L1 is degraded by ClpXP. The fact that the C-terminal ssrA-tag is attached directly to beta-strand 6, which is located at the centre of the core beta-sheet structure, may explain the resistance of UCH-L1-ssrA to ClpXP-induced degradation. Mutant UCH-L1-ssrA F162A is stabilised by the mutation, mutant UCH-L1-ssrA F165A is very destabilised
-
-
?
Unfolded polypeptides + H2O
short peptides of 5-15 amino acids
-
broad specificity
-
?
Y(3-NO2)-RGIT2-aminobutyric acid-SGRQ-K(anthranilamide) + H2O
Y(3-NO2)-RGIT2-aminobutyrate + SGRQ-K(anthranilamide)
-
-
-
-
?
Y(3-NO2)-RGITCSGRQ-K(anthranilamide) + H2O
Y(3-NO2)-RGITC + SGRQ-K(anthranilamide)
YbeA-ssrA + H2O
?
YbeA is a alpha/beta-knot methyltransferase from Escherichia coli and a deeply 31-knotted protein. Dimeric YbeA-ssrA (ssrA-tagged fusion protein of YbeA) is degraded rapidly by ClpXP, the rate of ATP-hydrolysis by ClpXP is moderately stimulated during the degradation process. Process modeling, overview
-
-
?
YLEDQDMWRMSGIFR + H2O
?
-
degraded at rates within 50% of the F-QLRSLNGEWRFAWFPAPEAV-Q peptide
-
-
?
YRGIT-Abu-SGRQK(Bz) + H2O
?
-
-
-
-
?
YRGITCSGRQK(benzoic acid amide) + H2O
?
-
-
-
-
?
YRGITCSGRQK(benzoic acid) + H2O
?
-
S2 peptide
-
-
?
YRGITCSGRQK-(dansyl) + H2O
?
-
S4 peptide
-
-
?
YWQAFRQYPRLQGGF + H2O
?
-
degraded considerably faster than the F-QLRSLNGEWRFAWFPAPEAV-Q peptide
-
-
?
FRETN 89-98 + H2O
additional information
-
Abf2 + H2O
?
a yeast mitochondrial protein, homologuous to human mitochondrial TFAM protein. The substrate is protected from degradation when bound to a nucleic acid. Abf2 associates with both types of DNA, dsDNA and ssDNA
-
-
?
Abf2 + H2O
?
a yeast mitochondrial protein, homologuous to human mitochondrial TFAM protein
-
-
?
Abf2 + H2O
?
a yeast mitochondrial protein, homologuous to human mitochondrial TFAM protein. The substrate is protected from degradation when bound to a nucleic acid. Abf2 associates with both types of DNA, dsDNA and ssDNA
-
-
?
Abf2 + H2O
?
a yeast mitochondrial protein, homologuous to human mitochondrial TFAM protein
-
-
?
Abf2 + H2O
?
a yeast mitochondrial protein, homologuous to human mitochondrial TFAM protein. The substrate is protected from degradation when bound to a nucleic acid. Abf2 associates with both types of DNA, dsDNA and ssDNA
-
-
?
Abz-QLRSLNGEWRFAWFPAPEAV[Tyr(3-NO2)]A + H2O
?
i.e. F-beta20-Q peptide, a synthetic fluorogenic peptide
-
-
?
Abz-QLRSLNGEWRFAWFPAPEAV[Tyr(3-NO2)]A + H2O
?
-
i.e. F-beta20-Q peptide, the substrate is flanked by a fluorophore (Abz) and quencher (nitrotyrosine) pair
-
-
?
alpha-casein + H2O
?
-
-
-
-
?
alpha-casein + H2O
?
-
-
-
-
?
alpha-casein + H2O
?
-
-
-
?
alpha-casein + H2O
?
-
-
-
?
alpha-casein + H2O
?
-
-
-
?
alpha-casein + H2O
?
cleavage in an ATP-dependent manner
-
-
?
alpha-casein + H2O
?
cleavage in an ATP-dependent manner
-
-
?
apoTorA + H2O
?
-
a molybdoenzyme; immature TorA (apoTorA) is degraded in vivo and in vitro by the Lon protease. Enzyme Lon interacts with apoTorA but not with holoTorA. Enzyme Lon and TorD, the specific chaperone of TorA, compete for apoTorA binding, but TorD binding protects apoTorA against degradation
-
-
?
apoTorA + H2O
?
-
a molybdoenzyme, immature TorA (apoTorA) is degraded in vivo and in vitro by the Lon protease. Enzyme Lon interacts with apoTorA but not with holoTorA. Enzyme Lon and TorD, the specific chaperone of TorA, compete for apoTorA binding, but TorD binding protects apoTorA against degradation
-
-
?
ATP + H2O
phosphate + ADP
oligomeric organization of lon protease and ATP hydrolysis are necessary prerequisites of realization of the processive degradation of a protein substrate
-
-
?
ATP + H2O
phosphate + ADP
-
-
-
-
?
ATP + H2O
phosphate + ADP
-
high-affinity sites hydrolyze ATP very slowly, but support multiple rounds of peptide hydrolysis, while the low-affinity sites hydrolyze ATP quickly. Affinities of sites differ from one another 10fold. Hydrolysis at both the high- and low-affinity sites are necessary for optimal peptide cleavage and the stabilization of the conformational change associated with nucleotide binding
-
-
?
ATP + H2O
phosphate + ADP
-
-
-
?
ATP + H2O
phosphate + ADP
-
-
-
?
ATP + H2O
phosphate + ADP
-
-
-
?
ATP + H2O
phosphate + ADP
-
-
-
-
?
ATP + H2O
phosphate + ADP
-
-
-
-
?
ATP + H2O
phosphate + ADP
-
-
?
Bacteriophage lambda protein N + H2O
Hydrolyzed bacteriophage lambda protein N
-
-
-
-
?
Bacteriophage lambda protein N + H2O
Hydrolyzed bacteriophage lambda protein N
-
cleavage sites: Ala16-Gln, Ala-Glu, Ala-Lys, Leu-Asn, Leu-Glu, Ser-Lys, Cys-Ser
-
?
beta-casein + H2O
?
-
-
-
-
?
beta-casein + H2O
?
-
-
-
?
beta-casein + H2O
?
-
-
-
-
?
beta-casein + H2O
?
-
-
-
?
beta-casein + H2O
?
-
-
-
-
?
beta-casein + H2O
?
-
-
-
?
beta-casein + H2O
?
-
-
-
?
beta-casein + H2O
?
-
-
-
?
calpain 10 + H2O
?
-
-
-
-
?
calpain 10 + H2O
?
-
degradation of the mitochondrial matrix protease
-
-
?
calpain 10 + H2O
?
-
-
-
-
?
calpain 10 + H2O
?
-
degradation of the mitochondrial matrix protease
-
-
?
casein + H2O
?
-
-
-
?
casein + H2O
?
-
lon contains three distinct domains, an amino-terminal domain having an undefined function, a central ATPase domain crucial for substrate binding and unfolding, and a C-terminal peptidase domain
-
-
?
casein + H2O
?
-
ATP dependent degradation>
-
?
casein + H2O
hydrolyzed casein
-
-
-
-
?
casein + H2O
hydrolyzed casein
-
alpha-casein
-
-
?
casein + H2O
hydrolyzed casein
-
methylcasein
-
-
?
casein + H2O
hydrolyzed casein
-
beta-casein
-
-
?
casein + H2O
hydrolyzed casein
-
-
-
-
?
casein + H2O
hydrolyzed casein
-
alpha-casein
-
-
?
casein + H2O
hydrolyzed casein
-
methylcasein
-
-
?
casein + H2O
hydrolyzed casein
-
beta-casein
-
-
?
casein + H2O
hydrolyzed casein
-
guanidinated casein
-
-
?
casein + H2O
hydrolyzed casein
-
methylated alpha-casein
-
-
?
casein + H2O
hydrolyzed casein
alpha-casein
-
-
?
casein + H2O
hydrolyzed casein
-
alpha-casein
-
-
?
casein + H2O
hydrolyzed casein
-
methylcasein
-
-
?
casein + H2O
hydrolyzed casein
-
beta-casein
-
-
?
casein + H2O
hydrolyzed casein
-
-
-
-
?
casein + H2O
hydrolyzed casein
-
alpha-casein
-
-
?
casein + H2O
hydrolyzed casein
-
methylcasein
-
-
?
casein + H2O
hydrolyzed casein
-
beta-casein
-
-
?
casein + H2O
hydrolyzed casein
-
alpha-casein
-
-
?
casein + H2O
hydrolyzed casein
-
methylcasein
-
-
?
casein + H2O
hydrolyzed casein
-
beta-casein
-
-
?
casein + H2O
hydrolyzed casein
-
alpha-casein (alpha1-casein)
-
-
?
CcdA + H2O
?
-
-
-
-
?
CcdA + H2O
?
-
72-amino acid protein
-
?
cytochrome c oxidase subunit + H2O
?
-
-
-
?
cytochrome c oxidase subunit + H2O
?
-
-
-
?
cytochrome c oxidase subunit IVi1 + H2O
?
the phosphorylated IVi1 protein is degraded, while the phosphorylation-resistant S52A mutant protein is not degraded
-
-
?
cytochrome c oxidase subunit IVi1 + H2O
?
the phosphorylated IVi1 protein is degraded, while the phosphorylation-resistant S52A mutant protein is not degraded
-
-
?
cytochrome c oxidase subunit Vb + H2O
?
the phosphorylated Vb protein is degraded, while the phosphorylation-resistant S40A mutant protein is not degraded
-
-
?
cytochrome c oxidase subunit Vb + H2O
?
the phosphorylated Vb protein is degraded, while the phosphorylation-resistant S40A mutant protein is not degraded
-
-
?
DNA
?
-
DNA-binding site of lon is the ATPase domain
-
-
?
DNA
?
-
mitochondrial lon binds preferentially to single-stranded DNA in a sequence-dependent manner
-
-
?
FITC casein + H2O
?
-
-
-
-
?
FITC casein + H2O
?
-
presence of ATP stimulates reaction 10fold
-
-
?
Globin + H2O
?
-
-
-
-
?
Globin + H2O
?
-
beta-globin
-
-
?
Glucagon + H2O
Hydrolyzed glucagon
-
-
-
-
?
Glucagon + H2O
Hydrolyzed glucagon
-
cleavage sites: Leu6-Cys(SO3H), Leu17-Val, Ala14-Leu, Val18-Cys(SO3H)
-
?
glutaryl-AAF-4-methoxy-beta-naphthylamide + H2O
glutaryl-L-Ala-L-Ala-L-Phe + 4-methoxy-2-naphthylamine
preferred substrate
-
-
?
glutaryl-AAF-4-methoxy-beta-naphthylamide + H2O
glutaryl-L-Ala-L-Ala-L-Phe + 4-methoxy-2-naphthylamine
preferred substrate
-
-
?
Glutaryl-Ala-Ala-Ala-methoxynaphthylamide + H2O
Glutaryl-Ala-Ala-Ala + methoxynaphthylamine
-
hydrolyzed at 3-4% the rate of glutaryl-Ala-Ala-Phe-methoxynaphthylamide
-
-
?
Glutaryl-Ala-Ala-Ala-methoxynaphthylamide + H2O
Glutaryl-Ala-Ala-Ala + methoxynaphthylamine
-
hydrolyzed at 3-4% the rate of glutaryl-Ala-Ala-Phe-methoxynaphthylamide
-
?
glutaryl-Ala-Ala-Phe-4-methoxy-beta-naphthylamide + H2O
?
-
-
-
?
glutaryl-Ala-Ala-Phe-4-methoxy-beta-naphthylamide + H2O
?
-
-
-
?
glutaryl-Ala-Ala-Phe-4-methoxy-beta-naphthylamide + H2O
?
-
-
?
Glutaryl-Ala-Ala-Phe-methoxynaphthylamide + H2O
Glutaryl-Ala-Ala-Phe + methoxynaphthylamine
-
-
-
?
Glutaryl-Ala-Ala-Phe-methoxynaphthylamide + H2O
Glutaryl-Ala-Ala-Phe + methoxynaphthylamine
-
-
-
-
?
Glutaryl-Ala-Ala-Phe-methoxynaphthylamide + H2O
Glutaryl-Ala-Ala-Phe + methoxynaphthylamine
-
-
-
?
Glutaryl-Ala-Ala-Phe-methoxynaphthylamide + H2O
Glutaryl-Ala-Ala-Phe + methoxynaphthylamine
-
-
-
-
?
Glutaryl-Ala-Ala-Phe-methoxynaphthylamide + H2O
Glutaryl-Ala-Ala-Phe + methoxynaphthylamine
-
fluorogenic peptide, 0.3 mM
-
-
?
Glutaryl-Gly-Gly-Pro-methoxynaphthylamide + H2O
Glutaryl-Gly-Gly-Pro + methoxynaphthylamine
-
hydrolyzed at 6% the rate of glutaryl-Ala-Ala-Phe-methoxynaphthylamide
-
-
?
Glutaryl-Gly-Gly-Pro-methoxynaphthylamide + H2O
Glutaryl-Gly-Gly-Pro + methoxynaphthylamine
-
hydrolyzed at 6% the rate of glutaryl-Ala-Ala-Phe-methoxynaphthylamide
-
?
HilA + H2O
?
-
mediates proteolysis of the central transcription regulatory factor HilA, which controls the correct timing for the expression of virulence genes necessary for host invasion
-
-
?
HilA + H2O
?
-
mediates proteolysis of the central transcription regulatory factor HilA, which controls the correct timing for the expression of virulence genes necessary for host invasion
-
-
?
HrpG + H2O
?
-
the degradation tag is located at the N-terminus of the substrate. The N-terminal moiety of HrpG is required for Lon recognition
-
-
?
HrpG + H2O
?
-
the degradation tag is located at the N-terminus of the substrate
-
-
?
IbpA + H2O
?
-
-
-
?
IbpA + H2O
?
-
i.e. Escherichia coli small heat shock protein A. Lon degrades purified IbpA substantially more slowly than purified IbpB, which is a consequence of differences in maximal Lon degradation rates and not in substrate affinity. IbpB stimulates Lon degradation of IbpA both in vitro and in vivo. The variable N- and C-terminal tails of the Ibps contain critical determinants that control the maximal rate of Lon degradation
-
-
?
lambda phage N protein + H2O
?
-
-
-
?
lambda phage N protein + H2O
?
-
generation of a panel of fluorescent peptides based on the cleavage profile of substrate lambda phage N protein indicates that protease Lon recognizes numerous discontinouos substrate determinants throughout lambda N protein to achieve substrate promiscuity
-
-
?
lambda phage N protein + H2O
?
-
-
-
-
?
LasI + H2O
?
Lon is involved in the regulation of quorum-sensing signaling systems in Pseudomonas aeruginosa, the opportunistic human pathogen. The enzyme is part of the acyl-homoserine lactone-mediated QS system LasR/LasI, but LasR/LasI regulation is independent of the RhlR/RhlI system by Lon. QS systems are organized hierarchically: the RhlR/RhlI system is subordinate to LasR/LasI, Lon represses the expression of LasR/LasI by degrading LasI, an HSL synthase, leading to negative regulation of the RhlR/RhlI system, overview
-
-
?
LasI + H2O
?
hydrolytic degradation
-
-
?
mDHFR protein + H2O
?
-
sul20C-tagged protein, degradation
-
-
?
mDHFR protein + H2O
?
-
tittinI27-fusion and sul20C-tagged protein, to direct Lon degradation of a titinI27 domain, either the N or C terminus of this protein is fused to amino acids 3-93 of Escherichia coli beta-galactosidase, an unstructured sequence that contains the b20 degron, degradation
-
-
?
Melittin + H2O
?
-
-
-
-
?
Melittin + H2O
?
-
isolated proteolytic domain exhibits almost no activity toward casein, but hydrolyzes peptide substrates
-
?
Melittin + H2O
?
-
isolated proteolytic domain exhibits almost no activity toward casein, but hydrolyzes peptide substrates
-
?
Methylglobin + H2O
?
-
methyl-apohemoglobin
-
-
?
Methylglobin + H2O
?
-
-
-
-
?
MetR + H2O
?
a protein of the MetR regulon
-
-
?
MetR + H2O
?
a protein of the MetR regulon, transcriptional regulator of metE expression
-
-
?
Mgm101 + H2O
?
a yeast mitochondrial protein. The substrate is protected from degradation when bound to a nucleic acid
-
-
?
Mgm101 + H2O
?
a yeast mitochondrial protein
-
-
?
Mgm101 + H2O
?
a yeast mitochondrial protein. The substrate is protected from degradation when bound to a nucleic acid
-
-
?
Mgm101 + H2O
?
a yeast mitochondrial protein
-
-
?
Mgm101 + H2O
?
a yeast mitochondrial protein. The substrate is protected from degradation when bound to a nucleic acid
-
-
?
misfolded protein + H2O
?
-
-
-
-
?
misfolded protein + H2O
?
-
-
-
-
?
mitochondrial aconitase + H2O
?
-
essential enzyme, particularly susceptible to oxidative damage, preferentially oxidatively modified and inactivated during ageing
-
?
mitochondrial aconitase + H2O
?
when misfolded or unfolded
-
-
?
mitochondrial processing peptidase alpha subunit + H2O
?
-
human lon initiates substrate cleavage at surface exposed sites, lon degrades mitochondrial processing peptidase alpha subunit only when it is folded
-
-
?
mitochondrial processing peptidase alpha subunit + H2O
?
-
is degraded only when it is folded, trypsin-resistant and competent for assembly into an active enzyme
-
-
?
MPPalpha + H2O
?
-
mitochondrial processing peptidase alpha-subunit (MPPalpha), to show that mitochondrial Lon also degrades folded proteins and initiates substrate cleavage non-processively. Two mitochondrial substrates with known or homology-derived three-dimensional structures are used
-
-
?
MPPalpha + H2O
?
-
mitochondrial processing peptidase alpha-subunit (MPPalpha), to show that mitochondrial Lon also degrades folded proteins and initiates substrate cleavage non-processively. Two mitochondrial substrates with known or homology-derived three-dimensional structures are used
-
-
?
MrpL32 + H2O
?
human MrpL32, a component of the 39S large subunit of the mitochondrial ribosome
-
-
?
MrpL32 + H2O
?
human MrpL32, a component of the 39S large subunit of the mitochondrial ribosome. The substrate is protected from degradation when bound to a nucleic acid
-
-
?
Oxidized insulin B-chain + H2O
Hydrolyzed insulin B-chain
-
cleavage sites
-
?
Oxidized insulin B-chain + H2O
Hydrolyzed insulin B-chain
-
cleavage sites
-
-
?
PpuR + H2O
?
-
-
-
?
Proteins with highly abnormal conformation + H2O
?
-
one of the heat-shock proteins under control of rpoH operon(htp R)
-
-
?
Proteins with highly abnormal conformation + H2O
?
-
rate-limiting step in breakdown of highly abnormal and some normal proteins
-
-
?
Proteins with highly abnormal conformation + H2O
?
-
catalyzes inital step in the degradation of proteins with abnormal conformation as may result from nonsense or missense mutations, biosynthetic errors or intracellular denaturation
-
-
?
RcsA + H2O
?
-
-
-
?
RcsA + H2O
?
-
protein degradation mediates the turnover of damaged proteins
-
?
ribosomal S2 protein + H2O
?
-
-
-
-
?
ribosomal S2 protein + H2O
?
-
degradation of S2 protein occurs in a processive manner. P1 and P3 sites of cleavage products are predominantly occupied by hydrophobic residues
-
-
?
ribosomal S2 protein + H2O
?
-
major lon cleavages sites within the bacterial S2 ribosomal protein located at the interior of the molecule
-
-
?
StAR + H2O
?
-
steroidogenic acute regulatory protein (StAR), to show that mitochondrial Lon also degrades folded proteins and initiates substrate cleavage non-processively. Two mitochondrial substrates with known or homology-derived three-dimensional structures are used
-
-
?
StAR + H2O
?
-
steroidogenic acute regulatory protein (StAR), to show that mitochondrial Lon also degrades folded proteins and initiates substrate cleavage non-processively. Two mitochondrial substrates with known or homology-derived three-dimensional structures are used
-
-
?
steroidogenic acute regulatory protein + H2O
?
-
-
-
-
?
steroidogenic acute regulatory protein + H2O
?
-
-
-
?
steroidogenic acute regulatory protein + H2O
?
-
human lon initiates substrate cleavage at surface exposed sites
-
-
?
steroidogenic acute regulatory protein + H2O
?
-
i.e. StAR protein, an endogenous substrate
-
-
?
steroidogenic acute regulatory protein + H2O
?
-
-
-
-
?
Succinyl-Ala-Ala-Phe-methoxynaphthylamide + H2O
Succinyl-Ala-Ala-Phe + methoxynaphthylamine
-
best substrate
-
-
?
Succinyl-Ala-Ala-Phe-methoxynaphthylamide + H2O
Succinyl-Ala-Ala-Phe + methoxynaphthylamine
-
best substrate
-
?
Succinyl-Ala-Ala-Phe-methoxynaphthylamide + H2O
Succinyl-Ala-Ala-Phe + methoxynaphthylamine
-
hydrolyzed at 137% the rate of glutaryl-Ala-Ala-Phe-methoxynaphthylamide
-
?
succinyl-FLF-4-methoxy-beta-naphthylamide + H2O
succinyl-FLF + 4-methoxy-beta-naphthylamine
-
-
-
?
succinyl-FLF-4-methoxy-beta-naphthylamide + H2O
succinyl-FLF + 4-methoxy-beta-naphthylamine
-
-
-
?
Succinyl-Phe-Ala-Phe-methoxynaphthylamide + H2O
Succinyl-Phe-Ala-Phe + methoxynaphthylamine
-
-
-
?
Succinyl-Phe-Ala-Phe-methoxynaphthylamide + H2O
Succinyl-Phe-Ala-Phe + methoxynaphthylamine
-
-
-
-
?
Succinyl-Phe-Ala-Phe-methoxynaphthylamide + H2O
Succinyl-Phe-Ala-Phe + methoxynaphthylamine
-
-
-
?
Succinyl-Phe-Ala-Phe-methoxynaphthylamide + H2O
Succinyl-Phe-Ala-Phe + methoxynaphthylamine
-
fluorogenic peptide, hydrolyzed at 75% the rate of glutaryl-Ala-Ala-Phe-methoxynaphthylamide
-
-
?
Succinyl-Phe-Ala-Phe-methoxynaphthylamide + H2O
Succinyl-Phe-Ala-Phe + methoxynaphthylamine
-
-
-
?
succinyl-Phe-Leu-Phe-4-methoxy-beta-naphthylamide + H2O
?
-
-
-
?
succinyl-Phe-Leu-Phe-4-methoxy-beta-naphthylamide + H2O
?
-
-
-
?
succinyl-Phe-Leu-Phe-4-methoxy-beta-naphthylamide + H2O
?
-
-
?
SulA + H2O
?
i.e. cell division inhibitor
-
-
?
SulA + H2O
?
-
physiological substrate SulA3-169 and SulA23-169
-
?
SulA + H2O
?
-
inactivation of SulA through the enzyme in vivo requires binding to the N domain and robust ATP hydrolysis but does not require degradation or translocation into the proteolytic chamber
-
-
?
SulA + H2O
?
a cell division inhibitor
-
-
?
SulA + H2O
?
-
a cell division inhibitor
-
-
?
TFAM + H2O
?
only DNA-free TFAM is a substrate for human mitochondrial Lon. TFAM is released from DNA upon phosphorylation by protein kinase A, and TFAM not bound to DNA, whether phosphorylated or not, is a substrate for the ATP-dependent mitochondrial Lon protease
-
-
?
TFAM + H2O
?
only DNA-free TFAM is a substrate for human mitochondrial Lon. The substrate is protected from degradation when bound to a nucleic acid
-
-
?
tmRNA-tagged protein + H2O
?
-
-
-
-
?
tmRNA-tagged protein + H2O
?
-
highly purified lon preferentially degrades tmRNA-tagged forms of proteins compared to untagged forms
-
-
?
Twinkle helicase + H2O
?
a human mitochondrial protein
-
-
?
Twinkle helicase + H2O
?
a human mitochondrial protein. The substrate is not protected from degradation when bound to a nucleic acid. Twinkle is degraded by hLon even in the presence of both ssDNA and dsDNA with either 3' or 5' overhangs
-
-
?
Y(3-NO2)-RGITCSGRQ-K(anthranilamide) + H2O
Y(3-NO2)-RGITC + SGRQ-K(anthranilamide)
-
-
-
-
?
Y(3-NO2)-RGITCSGRQ-K(anthranilamide) + H2O
Y(3-NO2)-RGITC + SGRQ-K(anthranilamide)
-
-
-
-
?
FRETN 89-98 + H2O
additional information
-
-
peptide-based substrate containing the Y(NO2)-Abz internal fluorescence quenching pair and peptide sequence RGITCSGRQK, also substrate for human protease ClpXP
cleavage of the peptide at Cys-Ser
-
?
additional information
?
-
-
enzyme is required for proper expression, assembly or function of the VirB/D4-mediated T-DNA transfer system
-
-
?
additional information
?
-
wild-type shows considerable ATP-dependent activity when assayed at 70°C
-
-
?
additional information
?
-
-
wild-type shows considerable ATP-dependent activity when assayed at 70°C
-
-
?
additional information
?
-
-
proteolytic domain and a large transmembrane domain insertion within the AAA+ module between the Walker motifs A and B
-
-
?
additional information
?
-
LonB protease shows ATPase and protease activities
-
-
?
additional information
?
-
LonB protease shows ATPase and protease activities
-
-
?
additional information
?
-
LonB protease shows ATPase and protease activities
-
-
?
additional information
?
-
LonB protease shows ATPase and protease activities
-
-
?
additional information
?
-
LonB protease shows ATPase and protease activities
-
-
?
additional information
?
-
-
substrate specificity of isoforms LonA, LonB and of protease Clp can be determined, in part, by the spatial and temporal organization of the proteases in vivo
-
-
?
additional information
?
-
-
the alpha-domain from Lon binds to the duplex nucleotide sequence 5'-CTGTTAGCGGGC-3' from pET28a plasmid DNA sequence map and protects it from DNase I digestion. The Brevibacillus thermoruber Lon alpha-domain binds with 5'-CTGTTAGCGGGC-3' double-stranded DNA tighter than Lon alpha-domains from Escherichia coli and Bacillus subtilis, whereas the Brevibacillus thermoruber Lon alpha-domain has dramatically lower affinity for double-stranded DNA with 0 and 50% identity to the 5'-CTGTTAGCGGGC-3' binding sequence
-
-
?
additional information
?
-
the ATPase and the proteolytic domains function independently. Introduction of a mutation into the proteolytic domain does not affect the ability of Lon-1 to hydrolyze ATP. Lon-1 does not degrade Borrelia-SsrA tagged reporter protein in vitro
-
-
?
additional information
?
-
the ATPase and the proteolytic domains function independently. Introduction of a mutation into the proteolytic domain does not affect the ability of Lon-1 to hydrolyze ATP. Lon-1 does not degrade Borrelia-SsrA tagged reporter protein in vitro
-
-
?
additional information
?
-
-
the ATPase and the proteolytic domains function independently. Introduction of a mutation into the proteolytic domain does not affect the ability of Lon-1 to hydrolyze ATP. Lon-1 does not degrade Borrelia-SsrA tagged reporter protein in vitro
-
-
?
additional information
?
-
-
the alpha-domain from Lon binds to the duplex nucleotide sequence 5'-CTGTTAGCGGGC-3' from pET28a plasmid DNA sequence map and protects it from DNase I digestion. The Brevibacillus thermoruber Lon alpha-domain binds with 5'-CTGTTAGCGGGC-3' double-stranded DNA tighter than Lon alpha-domains from Escherichia coli and Bacillus subtilis, whereas the Brevibacillus thermoruber Lon alpha-domain has dramatically lower affinity for double-stranded DNA with 0 and 50% identity to the 5'-CTGTTAGCGGGC-3' binding sequence
-
-
?
additional information
?
-
-
the alpha-domain from Lon binds to the duplex nucleotide sequence 5'-CTGTTAGCGGGC-3' from pET28a plasmid DNA sequence map and protects it from DNase I digestion. The Brevibacillus thermoruber Lon alpha-domain binds with 5'-CTGTTAGCGGGC-3' double-stranded DNA tighter than Lon alpha-domains from Escherichia coli and Bacillus subtilis, whereas the Brevibacillus thermoruber Lon alpha-domain has dramatically lower affinity for double-stranded DNA with 0 and 50% identity to the 5'-CTGTTAGCGGGC-3' binding sequence
-
-
?
additional information
?
-
-
-
-
-
?
additional information
?
-
-
No substrates are native bovine serum albumin, hemoglobin
-
-
?
additional information
?
-
-
No substrates are native bovine serum albumin, hemoglobin
-
-
?
additional information
?
-
-
ATP-dependent serine protease
-
-
?
additional information
?
-
-
ATP-dependent serine protease
-
-
?
additional information
?
-
-
ATP-dependent serine protease
-
-
?
additional information
?
-
-
No substrates are native albumin
-
-
?
additional information
?
-
-
No substrates are glutaryl-Phe-7-amino-4-methylcoumarin, Ala-Ala-Phe-methoxynaphthylamide, Gly-Phe-methoxynaphthylamide, Asp-methoxynaphthylamide, Leu-methoxynaphthylamide, Arg-methoxynaphthylamide, Ala-methoxynaphthylamide, Tyr-methoxynaphthylamide, Lys-methoxynaphthylamide, methoxyglutaryl-Ala-Ala-Phe-methoxynaphthylamide, methoxysuccinyl-Ala-Ala-Phe-methoxynaphthylamide, benzyloxycarbonyl-Ala-Pro-methoxynaphthylamide, benzoyl-Arg-Gly-Phe-Phe-Leu-methoxynaphthylamide, benzoyl-Arg-Gly-Leu-methoxynaphthylamide, Leu-Gly-Gly-methoxynaphthylamide, Ser-Tyr-methoxynaphthylamide
-
-
?
additional information
?
-
-
with DNA-binding ability
-
-
?
additional information
?
-
-
cleavage specificity
-
-
?
additional information
?
-
-
No substrates are lambda-repressors cI and Cro, lambda replication protein O, E. coli galactose repressor, even after heat denaturation
-
-
?
additional information
?
-
-
the active site prefers hydrophobic substrate sequences
-
-
?
additional information
?
-
-
mutant enzyme in which active site Ser-679 is replaced by Ala lacks peptidase but retains ATPase activity
-
-
?
additional information
?
-
-
no phosphorylation of enzyme or substrate during ATP hydrolysis
-
-
?
additional information
?
-
-
with a proteolytic and an ATP-binding site per monomer
-
-
?
additional information
?
-
-
No substrates are benzyloxycarbonyl-Ala-Arg-Arg-methoxynaphthylamide, native or denatured ribonuclease, native or denatured lysozyme, native immunoglobulin G
-
-
?
additional information
?
-
-
can bind to a TG-rich DNA promoter element in a sequence-specific manner
-
?
additional information
?
-
-
isolated proteolytic domain exhibits the peptidase activity
-
?
additional information
?
-
-
essential for growth of yeast on nonfermentable carbon sources
-
-
?
additional information
?
-
-
rapid proteolysis plays a major role in post-translational cellular control by the targeted degradation of short-lived regulatory proteins
-
?
additional information
?
-
-
recognition and selective degradation of abnormal and unstable proteins
-
?
additional information
?
-
-
regulation of several important cellular functions, including radiation resistance, cell division, filamentation, capsular polysaccharide production, lysogeny of certain bacteriophages, and proteolytic degradation of certain regulatory and abnormal proteins
-
?
additional information
?
-
-
enzyme and protease Clp participate in the physiological disintegration of cytoplasmic inclusion bodies, their absence minimizing the protein removal up to 40%. Clp takes the major and enzyme a minor role in processing of aggregation-prone proteins and also of polypeptides physiologically released from inclusion bodies
-
-
?
additional information
?
-
-
the polyphosphate-lon complex does not degrade intact native ribosomes
-
-
?
additional information
?
-
-
proteolytic domain and a a large N-terminal domain, active site has a Ser-Lys catalytic dyad. Proteolytic domain exhibits no detectable activity against protein substrates degraded by full-length lon, but retains a significant fraction of peptidase activity
-
-
?
additional information
?
-
-
protease Lon recognizes specific sequences rich in aromatic residues that are accessible in unfolded polypeptides but hidden in most native structures. Denatured polypeptides lacking such sequences are poor substrates. Lon also unfolds and degrades stably folded proteins with accessible recognition tags. Lon can recognize multiple signals in unfolded polypeptides synergistically, resulting in nanomolar binding and a mechanism for discriminating irreversibly damaged proteins from transiently unfolded elements of structure
-
-
?
additional information
?
-
-
enzyme recognizes degrons, i.e. degradation tags. Degron tags are also regulatory elements that determine protease activity levels. Different tags fused to the same protein change degradation speeds and energetic efficiencies by 10fold or more. Degron binding to multiple sites in the Lon hexamer differentially stabilizes specific enzyme conformations, including one with high protease and low ATPase activity, and results in positively cooperative degradation
-
-
?
additional information
?
-
-
Lon possesses an intrinsic ATPase activity that is stimulated by protein and certain peptide substrates. The ATPase reaction catalyzed by Lon in the presence and absence of peptide substrate that stimulates the enzyme's ATPase activity is irreversible. The half-site ATPase reactivity of Lon can be used to account for the kinetic mechanism of the ATP-dependent peptidase activity of the enzyme
-
-
?
additional information
?
-
-
the alpha-domain from Lon binds to the duplex nucleotide sequence 5'-CTGTTAGCGGGC-3' from pET28a plasmid DNA sequence map and protects it from DNase I digestion. The Brevibacillus thermoruber Lon alpha-domain binds with 5'-CTGTTAGCGGGC-3' double-stranded DNA tighter than Lon alpha-domains from Escherichia coli and Bacillus subtilis, whereas the Brevibacillus thermoruber Lon alpha-domain has dramatically lower affinity for double-stranded DNA with 0 and 50% identity to the 5'-CTGTTAGCGGGC-3' binding sequence
-
-
?
additional information
?
-
-
homooligomeric ATP-dependent LonA proteases are bifunctional enzymes
-
-
?
additional information
?
-
-
repeated cycles of ATP binding and hydrolysis power conformational changes that pull the tag through the pore and eventually tug the native portion of the substrate against the AAA+ ring, creating an unfolding force. Depending on the native substrate and enzyme, successful unfolding can require anywhere from a few to many hundreds of cycles of ATP hydrolysis
-
-
?
additional information
?
-
-
compared with hexamers, enzyme dodecamers are much less active in degrading large substrates but equally active in degrading small substrates, whcih represents a a unique gating mechanism that allows the repertoire of enzyme substrates to be tuned by its assembly state
-
-
?
additional information
?
-
-
native enzyme hydrolyzes ATP in the absence of a protein substrate
-
-
?
additional information
?
-
-
substrate specifiicty, overview. GFP-fusion proteins resist Lon degradation from the N-terminus. Partially degraded substrate fragments accumulate as proteolytic products, which is often observed during degradation in vitro of multi-domain substrates containing very stable interior domains
-
-
?
additional information
?
-
a quantitative Super-SILAC (stable isotope labeling with amino acids in cell culture) mass spectrometry approach and analysis of proteomes of a lon mutant and a strain producing the protease are employed to determine substrate specificity and Lon-dependent physiological functions. The recognition mechanisms of known Lon substrates are highly diverse. Misfolded proteins are mainly recognized by short, hydrophobic stretches normally buried in the core of natively folded proteins. In contrast, recognition of SulA occurs via its C-terminus with a critical histidine and tyrosine at its very end
-
-
?
additional information
?
-
-
a quantitative Super-SILAC (stable isotope labeling with amino acids in cell culture) mass spectrometry approach and analysis of proteomes of a lon mutant and a strain producing the protease are employed to determine substrate specificity and Lon-dependent physiological functions. The recognition mechanisms of known Lon substrates are highly diverse. Misfolded proteins are mainly recognized by short, hydrophobic stretches normally buried in the core of natively folded proteins. In contrast, recognition of SulA occurs via its C-terminus with a critical histidine and tyrosine at its very end
-
-
?
additional information
?
-
Escherichia coli Lon binds both single stranded DNA (ssDNA) and RNA (ssRNA), and double stranded DNA (dsDNA) in a non-specific manner, and this interaction enhances Lon ATPase and proteolytic activities
-
-
?
additional information
?
-
enzyme Ec-Lon interacts with DNA. Ec-Lon protease forms complexes with aptamers, obtained from thrombin, whose molecules comprise the duplex domains and G-quadruplex region. The aptamers have low affinities for the enzyme mutant S679A, the Lon protease does not show a strong ability to bind to any individual Gx02quadruplex (15TBA) or duplex aptamer (RE15T), but Lonx02 S679A forms complexes with twox02domain 31TBA, RE31 and ST43 aptamers
-
-
?
additional information
?
-
Lon protease has three activities: intrinsic ATPase, substrate-stimulated ATPase, and ATP-dependent proteolysis. Lon preferentially degrades damaged or misfolded proteins at its proteolytic site while the ATP is bound and hydrolyzed into ADP and phosphate at its ATPase site
-
-
?
additional information
?
-
-
Lon protease has three activities: intrinsic ATPase, substrate-stimulated ATPase, and ATP-dependent proteolysis. Lon preferentially degrades damaged or misfolded proteins at its proteolytic site while the ATP is bound and hydrolyzed into ADP and phosphate at its ATPase site
-
-
?
additional information
?
-
N-terminally truncated enzyme ClpXP can easily degrade a deeply 31-knotted and 52-knotted proteins. The degradation depends critically on the location of the degradation tag and the local stability near the tag
-
-
?
additional information
?
-
the enzyme is able to undergo autolysis and to bind DNA, analysis of formation of enzyme-DNA complexes
-
-
?
additional information
?
-
-
the enzyme is able to undergo autolysis and to bind DNA, analysis of formation of enzyme-DNA complexes
-
-
?
additional information
?
-
-
isolated proteolytic domain exhibits the peptidase activity
-
?
additional information
?
-
-
can bind to a TG-rich DNA promoter element in a sequence-specific manner
-
?
additional information
?
-
-
regulation of several important cellular functions, including radiation resistance, cell division, filamentation, capsular polysaccharide production, lysogeny of certain bacteriophages, and proteolytic degradation of certain regulatory and abnormal proteins
-
?
additional information
?
-
-
proteomes of wild-type and a lon-abi conditional mutant are compared by quantitative high-throughput proteomics in order to understand the global impact of the LonB protease on archaeal physiology and to discover its potential protein substrates. Proteins enriched in the lon mutant (soluble and membrane associated polypeptides) represent potential natural substrates of the membrane protease LonB
-
-
?
additional information
?
-
LonB protease shows ATPase and protease activities
-
-
?
additional information
?
-
-
LonB protease shows ATPase and protease activities
-
-
?
additional information
?
-
LonB protease shows ATPase and protease activities
-
-
?
additional information
?
-
LonB protease shows ATPase and protease activities
-
-
?
additional information
?
-
LonB protease shows ATPase and protease activities
-
-
?
additional information
?
-
-
proteomes of wild-type and a lon-abi conditional mutant are compared by quantitative high-throughput proteomics in order to understand the global impact of the LonB protease on archaeal physiology and to discover its potential protein substrates. Proteins enriched in the lon mutant (soluble and membrane associated polypeptides) represent potential natural substrates of the membrane protease LonB
-
-
?
additional information
?
-
LonB protease shows ATPase and protease activities
-
-
?
additional information
?
-
LonB protease shows ATPase and protease activities
-
-
?
additional information
?
-
LonB protease shows ATPase and protease activities
-
-
?
additional information
?
-
LonB protease shows ATPase and protease activities
-
-
?
additional information
?
-
-
participates directly in the metabolism of mitochodrial DNA
-
?
additional information
?
-
-
ATP stimulated protease may be an essential defence against the stress of life in an oxygen environment
-
?
additional information
?
-
-
enzyme participates directly in the metabolism of mitochondrial DNA
-
-
?
additional information
?
-
-
lon interacts with the mitochondrial genome in cultured cells. Associates with sites distributed primarily within one-half of the genome and preferentially with the control region for mitochondrial DNA replication and transcription, which has a G-rich consensus sequence
-
-
?
additional information
?
-
-
does not process PTS2 protein-containing 3-ketoacyl-coenzyme A thiolase
-
-
?
additional information
?
-
-
the enzyme and sirtuin 3 interact, but sirtuin 3 is not a substrate for Lon activity
-
-
?
additional information
?
-
Lon efficiency in proteolysis can vary according to the status of its targets
-
-
?
additional information
?
-
Lon protease has three activities: intrinsic ATPase, substrate-stimulated ATPase, and ATP-dependent proteolysis. Lon preferentially degrades damaged or misfolded proteins at its proteolytic site while the ATP is bound and hydrolyzed into ADP and phosphate at its ATPase site
-
-
?
additional information
?
-
-
Lon protease has three activities: intrinsic ATPase, substrate-stimulated ATPase, and ATP-dependent proteolysis. Lon preferentially degrades damaged or misfolded proteins at its proteolytic site while the ATP is bound and hydrolyzed into ADP and phosphate at its ATPase site
-
-
?
additional information
?
-
-
lacking the ATPase domain
-
?
additional information
?
-
-
the enzyme selectively degrades unfolded protein substrates in an ATP-independent manner, structural basis of substrate recognition, overview
-
-
?
additional information
?
-
recombinant Lon-like-Ms exhibits ATPase activity and cleavage activity toward fluorogenic peptides and casein. The peptidase activity of Lon-like-Ms relies strictly on Mg2+ (or other divalent cations) and ATP
-
-
?
additional information
?
-
-
recombinant Lon-like-Ms exhibits ATPase activity and cleavage activity toward fluorogenic peptides and casein. The peptidase activity of Lon-like-Ms relies strictly on Mg2+ (or other divalent cations) and ATP
-
-
?
additional information
?
-
recombinant Lon-like-Ms exhibits ATPase activity and cleavage activity toward fluorogenic peptides and casein. The peptidase activity of Lon-like-Ms relies strictly on Mg2+ (or other divalent cations) and ATP
-
-
?
additional information
?
-
-
mediates the degradation of misfolded, unassembled or oxidatively damaged polypeptides, not only degrades protein substrates but also binds DNA, specifically binds to single stranded but not to double-stranded DNA oligonucleotides
-
?
additional information
?
-
three-dimensional modeling of cytochrome c oxidase (CcO)-Lon complex based on the X-ray crystal structures of bovine CcO complex and Escherichia coli Lon protein, interaction analysis, docking study
-
-
?
additional information
?
-
-
three-dimensional modeling of cytochrome c oxidase (CcO)-Lon complex based on the X-ray crystal structures of bovine CcO complex and Escherichia coli Lon protein, interaction analysis, docking study
-
-
?
additional information
?
-
-
succinyl-Leu-Leu-Val-Tyr-4-methylcoumarin-7-amide is not cleaved
-
?
additional information
?
-
-
lacks 90, 225, or 277 N-terminal residues, practically no proteolytic activity while exhibiting reduced protein binding activity
-
-
?
additional information
?
-
-
Lon can efficiently and selectively degrade tmRNA-tagged proteins. The larger, 27 amino acids long, tmRNA tag contains multiple discrete signalling motifs for efficient recognition and rapid degradation by Lon. Lon-mediated degradation process absolutely depends on the presence of ATP, and tmRNA-tagged reporter protein degradation is dependent on the presence of full-length tmRNA tag
-
-
?
additional information
?
-
LonB protease showed ATPase and protease activities. The enzyme has DNA-binding capacity in vitro
-
-
?
additional information
?
-
LonB protease showed ATPase and protease activities. The enzyme has DNA-binding capacity in vitro
-
-
?
additional information
?
-
LonB protease showed ATPase and protease activities. The enzyme has DNA-binding capacity in vitro
-
-
?
additional information
?
-
LonB protease showed ATPase and protease activities. The enzyme has DNA-binding capacity in vitro
-
-
?
additional information
?
-
LonB protease showed ATPase and protease activities. The enzyme has DNA-binding capacity in vitro
-
-
?
additional information
?
-
LonB protease showed ATPase and protease activities. The enzyme has DNA-binding capacity in vitro
-
-
?
additional information
?
-
LonB protease showed ATPase and protease activities. The enzyme has DNA-binding capacity in vitro
-
-
?
additional information
?
-
LonB protease showed ATPase and protease activities. The enzyme has DNA-binding capacity in vitro
-
-
?
additional information
?
-
three-dimensional modeling of cytochrome c oxidase (CcO)-Lon complex based on the X-ray crystal structures of bovine CcO complex and Escherichia coli Lon protein, interaction analysis, docking study
-
-
?
additional information
?
-
-
three-dimensional modeling of cytochrome c oxidase (CcO)-Lon complex based on the X-ray crystal structures of bovine CcO complex and Escherichia coli Lon protein, interaction analysis, docking study
-
-
?
additional information
?
-
-
protease Lon represses the expression of LasR/LasI by degrading HSL synthase LasI, leading to negative regulation of the RhlR/RhlI system. RhlI/RhlR is also regulated by Lon independently of LasI/LasR
-
-
?
additional information
?
-
protease Lon represses the expression of LasR/LasI by degrading HSL synthase LasI, leading to negative regulation of the RhlR/RhlI system. RhlI/RhlR is also regulated by Lon independently of LasI/LasR
-
-
?
additional information
?
-
is a negative regulator of acyl homoserine lactone production
-
-
?
additional information
?
-
-
is a negative regulator of acyl homoserine lactone production
-
-
?
additional information
?
-
is a negative regulator of acyl homoserine lactone production
-
-
?
additional information
?
-
-
ATP-dependent serine protease
-
-
?
additional information
?
-
-
ATP-dependent serine protease
-
-
?
additional information
?
-
-
ATP-dependent serine protease
-
-
?
additional information
?
-
-
protease and ATPase activity, bovine serum albumin is no substrate
-
?
additional information
?
-
-
involved in mitochondrial protein turnover
-
-
?
additional information
?
-
-
required for expression of intron-containing genes in mitochondria, required for selective proteolysis in the matrix, maintenance of mitochondrial DNA, and respiration-dependent growth
-
?
additional information
?
-
-
required for mitochondrial function
-
?
additional information
?
-
-
required for selective proteolysis in the matrix, maintenance of mitochondrial DNA, and respiration-dependent growth
-
?
additional information
?
-
-
required for selective proteolysis in the matrix, maintenance of mitochondrial DNA, and respiration-dependent growth, protein degradation in mitochondrial homeostasis
-
?
additional information
?
-
-
enzyme recognizes specific surface determinants or folds, initiates proteolysis at solvent-accessible sites, and generates unfolded polypeptides that are then processively degraded
-
-
?
additional information
?
-
-
construct containing residues 793-1133 of yeast lon, which comprises the proteolytic domain along with most of the alpha-domain, exhibits low but significant proteolytic activity in vivo
-
-
?
additional information
?
-
-
endogenous substrates, which are misfolded or unassembled subunits of electron transport chain complexes, ribosomal proteins and metabolic enzymes
-
-
?
additional information
?
-
-
yeast lon has a relatively poor ability to unravel proteins and is only able to degrade proteins that have unstable tertiary structure
-
-
?
additional information
?
-
Lon binding partners are NADH dehydrogenase ubiquinone iron-sulfur protein 8 (NDUFS8), heat shock protein (Hsp)-60, and mtHsp70
-
-
?
additional information
?
-
Lon binding partners are NADH dehydrogenase ubiquinone iron-sulfur protein 8 (NDUFS8), heat shock protein (Hsp)-60, and mtHsp70
-
-
?
additional information
?
-
belonging to AAA+ superfamily
-
?
additional information
?
-
LonB protease shows ATPase and protease activities. Membrane-bound ATP-dependent Lon protease from Thermococcus kodakaraensis shows ATP-independent activity on unfolded substrates and ATP-dependent activity on folded proteins
-
-
?
additional information
?
-
LonB protease shows ATPase and protease activities
-
-
?
additional information
?
-
recombinant LonB protease shows ATPase and protease activities
-
-
?
additional information
?
-
recombinant LonB protease shows ATPase and protease activities
-
-
?
additional information
?
-
recombinant LonB protease shows ATPase and protease activities
-
-
?
additional information
?
-
recombinant LonB protease shows ATPase and protease activities
-
-
?
additional information
?
-
recombinant LonB protease shows ATPase and protease activities
-
-
?
additional information
?
-
-
proteases ClpXP and Lon contribute to the environmental regulation of type III secretion system T3SS through regulated proteolysis of small histone-like protein YmoA
-
-
?
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
5-aminolevulinic acid synthase + H2O
?
-
-
-
?
Abnormal puromucyl peptides + H2O
?
-
not in vitro
-
-
?
acid resistance regulator GdE protein + H2O
?
-
degradation of GadE protein by Lon rapidly terminates the acid resistance response upon shift back to neutral pH and avoids overexpression of acid resistance genes in stationary phases
-
-
?
alpha-casein + H2O
?
-
-
-
-
?
apoTorA + H2O
?
-
a molybdoenzyme; immature TorA (apoTorA) is degraded in vivo and in vitro by the Lon protease. Enzyme Lon interacts with apoTorA but not with holoTorA. Enzyme Lon and TorD, the specific chaperone of TorA, compete for apoTorA binding, but TorD binding protects apoTorA against degradation
-
-
?
Bacteriophage lambda N-protein + H2O
?
-
-
-
-
?
Canavanine-containing proteins + H2O
?
-
not in vitro
-
-
?
CysB + H2O
?
a positive cysDNC operon transcription regulator
-
-
?
CysD + H2O
?
a subunit of the sulfate adenylyltransferase, low activity
-
-
?
cystathionine beta-synthase + H2O
?
when misfolded or unfolded
-
-
?
cytochrome c oxidase 4 isoform 1 + H2O
?
i.e. COX4-1
-
-
?
cytochrome c oxidase subunit + H2O
?
glutaminase C + H2O
?
when misfolded or unfolded
-
-
?
GlyA + H2O
?
a protein of the MetR regulon
-
-
?
HrpG + H2O
?
-
the degradation tag is located at the N-terminus of the substrate. The N-terminal moiety of HrpG is required for Lon recognition
-
-
?
LasI + H2O
?
Lon is involved in the regulation of quorum-sensing signaling systems in Pseudomonas aeruginosa, the opportunistic human pathogen. The enzyme is part of the acyl-homoserine lactone-mediated QS system LasR/LasI, but LasR/LasI regulation is independent of the RhlR/RhlI system by Lon. QS systems are organized hierarchically: the RhlR/RhlI system is subordinate to LasR/LasI, Lon represses the expression of LasR/LasI by degrading LasI, an HSL synthase, leading to negative regulation of the RhlR/RhlI system, overview
-
-
?
MetR + H2O
?
a protein of the MetR regulon, transcriptional regulator of metE expression
-
-
?
mitochondrial aconitase + H2O
?
mitochondrial transcription factor A + H2O
?
i.e. TFAM
-
-
?
MrpL32 + H2O
?
human MrpL32, a component of the 39S large subunit of the mitochondrial ribosome
-
-
?
Mutant form of alkaline phosphatase PhoA61 + H2O
?
-
not in vitro
-
-
?
Proteins with highly abnormal conformation + H2O
?
ribosomal S2 protein + H2O
?
-
-
-
-
?
steroidogenic acute regulatory protein + H2O
?
-
-
-
?
TFAM + H2O
?
only DNA-free TFAM is a substrate for human mitochondrial Lon. TFAM is released from DNA upon phosphorylation by protein kinase A, and TFAM not bound to DNA, whether phosphorylated or not, is a substrate for the ATP-dependent mitochondrial Lon protease
-
-
?
tmRNA-tagged protein + H2O
?
-
-
-
-
?
Twinkle helicase + H2O
?
a human mitochondrial protein
-
-
?
additional information
?
-
Abf2 + H2O
?
a yeast mitochondrial protein, homologuous to human mitochondrial TFAM protein
-
-
?
Abf2 + H2O
?
a yeast mitochondrial protein, homologuous to human mitochondrial TFAM protein
-
-
?
calpain 10 + H2O
?
-
degradation of the mitochondrial matrix protease
-
-
?
calpain 10 + H2O
?
-
degradation of the mitochondrial matrix protease
-
-
?
cytochrome c oxidase subunit + H2O
?
-
-
-
?
cytochrome c oxidase subunit + H2O
?
-
-
-
?
Mgm101 + H2O
?
a yeast mitochondrial protein
-
-
?
Mgm101 + H2O
?
a yeast mitochondrial protein
-
-
?
mitochondrial aconitase + H2O
?
-
essential enzyme, particularly susceptible to oxidative damage, preferentially oxidatively modified and inactivated during ageing
-
?
mitochondrial aconitase + H2O
?
when misfolded or unfolded
-
-
?
Proteins with highly abnormal conformation + H2O
?
-
one of the heat-shock proteins under control of rpoH operon(htp R)
-
-
?
Proteins with highly abnormal conformation + H2O
?
-
rate-limiting step in breakdown of highly abnormal and some normal proteins
-
-
?
Proteins with highly abnormal conformation + H2O
?
-
catalyzes inital step in the degradation of proteins with abnormal conformation as may result from nonsense or missense mutations, biosynthetic errors or intracellular denaturation
-
-
?
RcsA + H2O
?
-
-
-
?
RcsA + H2O
?
-
protein degradation mediates the turnover of damaged proteins
-
?
SulA + H2O
?
-
-
-
?
SulA + H2O
?
-
physiological substrate SulA3-169 and SulA23-169
-
?
SulA + H2O
?
-
inactivation of SulA through the enzyme in vivo requires binding to the N domain and robust ATP hydrolysis but does not require degradation or translocation into the proteolytic chamber
-
-
?
SulA + H2O
?
a cell division inhibitor
-
-
?
SulA + H2O
?
-
a cell division inhibitor
-
-
?
additional information
?
-
-
enzyme is required for proper expression, assembly or function of the VirB/D4-mediated T-DNA transfer system
-
-
?
additional information
?
-
-
substrate specificity of isoforms LonA, LonB and of protease Clp can be determined, in part, by the spatial and temporal organization of the proteases in vivo
-
-
?
additional information
?
-
-
-
-
-
?
additional information
?
-
-
ATP-dependent serine protease
-
-
?
additional information
?
-
-
ATP-dependent serine protease
-
-
?
additional information
?
-
-
ATP-dependent serine protease
-
-
?
additional information
?
-
-
essential for growth of yeast on nonfermentable carbon sources
-
-
?
additional information
?
-
-
rapid proteolysis plays a major role in post-translational cellular control by the targeted degradation of short-lived regulatory proteins
-
?
additional information
?
-
-
recognition and selective degradation of abnormal and unstable proteins
-
?
additional information
?
-
-
regulation of several important cellular functions, including radiation resistance, cell division, filamentation, capsular polysaccharide production, lysogeny of certain bacteriophages, and proteolytic degradation of certain regulatory and abnormal proteins
-
?
additional information
?
-
-
enzyme and protease Clp participate in the physiological disintegration of cytoplasmic inclusion bodies, their absence minimizing the protein removal up to 40%. Clp takes the major and enzyme a minor role in processing of aggregation-prone proteins and also of polypeptides physiologically released from inclusion bodies
-
-
?
additional information
?
-
-
the polyphosphate-lon complex does not degrade intact native ribosomes
-
-
?
additional information
?
-
-
protease Lon recognizes specific sequences rich in aromatic residues that are accessible in unfolded polypeptides but hidden in most native structures. Denatured polypeptides lacking such sequences are poor substrates. Lon also unfolds and degrades stably folded proteins with accessible recognition tags. Lon can recognize multiple signals in unfolded polypeptides synergistically, resulting in nanomolar binding and a mechanism for discriminating irreversibly damaged proteins from transiently unfolded elements of structure
-
-
?
additional information
?
-
-
homooligomeric ATP-dependent LonA proteases are bifunctional enzymes
-
-
?
additional information
?
-
-
repeated cycles of ATP binding and hydrolysis power conformational changes that pull the tag through the pore and eventually tug the native portion of the substrate against the AAA+ ring, creating an unfolding force. Depending on the native substrate and enzyme, successful unfolding can require anywhere from a few to many hundreds of cycles of ATP hydrolysis
-
-
?
additional information
?
-
a quantitative Super-SILAC (stable isotope labeling with amino acids in cell culture) mass spectrometry approach and analysis of proteomes of a lon mutant and a strain producing the protease are employed to determine substrate specificity and Lon-dependent physiological functions. The recognition mechanisms of known Lon substrates are highly diverse. Misfolded proteins are mainly recognized by short, hydrophobic stretches normally buried in the core of natively folded proteins. In contrast, recognition of SulA occurs via its C-terminus with a critical histidine and tyrosine at its very end
-
-
?
additional information
?
-
-
a quantitative Super-SILAC (stable isotope labeling with amino acids in cell culture) mass spectrometry approach and analysis of proteomes of a lon mutant and a strain producing the protease are employed to determine substrate specificity and Lon-dependent physiological functions. The recognition mechanisms of known Lon substrates are highly diverse. Misfolded proteins are mainly recognized by short, hydrophobic stretches normally buried in the core of natively folded proteins. In contrast, recognition of SulA occurs via its C-terminus with a critical histidine and tyrosine at its very end
-
-
?
additional information
?
-
Escherichia coli Lon binds both single stranded DNA (ssDNA) and RNA (ssRNA), and double stranded DNA (dsDNA) in a non-specific manner, and this interaction enhances Lon ATPase and proteolytic activities
-
-
?
additional information
?
-
-
regulation of several important cellular functions, including radiation resistance, cell division, filamentation, capsular polysaccharide production, lysogeny of certain bacteriophages, and proteolytic degradation of certain regulatory and abnormal proteins
-
?
additional information
?
-
-
ATP stimulated protease may be an essential defence against the stress of life in an oxygen environment
-
?
additional information
?
-
-
enzyme participates directly in the metabolism of mitochondrial DNA
-
-
?
additional information
?
-
-
lon interacts with the mitochondrial genome in cultured cells. Associates with sites distributed primarily within one-half of the genome and preferentially with the control region for mitochondrial DNA replication and transcription, which has a G-rich consensus sequence
-
-
?
additional information
?
-
-
the enzyme and sirtuin 3 interact, but sirtuin 3 is not a substrate for Lon activity
-
-
?
additional information
?
-
-
protease Lon represses the expression of LasR/LasI by degrading HSL synthase LasI, leading to negative regulation of the RhlR/RhlI system. RhlI/RhlR is also regulated by Lon independently of LasI/LasR
-
-
?
additional information
?
-
protease Lon represses the expression of LasR/LasI by degrading HSL synthase LasI, leading to negative regulation of the RhlR/RhlI system. RhlI/RhlR is also regulated by Lon independently of LasI/LasR
-
-
?
additional information
?
-
-
ATP-dependent serine protease
-
-
?
additional information
?
-
-
ATP-dependent serine protease
-
-
?
additional information
?
-
-
ATP-dependent serine protease
-
-
?
additional information
?
-
-
involved in mitochondrial protein turnover
-
-
?
additional information
?
-
-
required for expression of intron-containing genes in mitochondria, required for selective proteolysis in the matrix, maintenance of mitochondrial DNA, and respiration-dependent growth
-
?
additional information
?
-
-
required for mitochondrial function
-
?
additional information
?
-
-
required for selective proteolysis in the matrix, maintenance of mitochondrial DNA, and respiration-dependent growth
-
?
additional information
?
-
-
required for selective proteolysis in the matrix, maintenance of mitochondrial DNA, and respiration-dependent growth, protein degradation in mitochondrial homeostasis
-
?
additional information
?
-
-
construct containing residues 793-1133 of yeast lon, which comprises the proteolytic domain along with most of the alpha-domain, exhibits low but significant proteolytic activity in vivo
-
-
?
additional information
?
-
Lon binding partners are NADH dehydrogenase ubiquinone iron-sulfur protein 8 (NDUFS8), heat shock protein (Hsp)-60, and mtHsp70
-
-
?
additional information
?
-
Lon binding partners are NADH dehydrogenase ubiquinone iron-sulfur protein 8 (NDUFS8), heat shock protein (Hsp)-60, and mtHsp70
-
-
?
additional information
?
-
-
proteases ClpXP and Lon contribute to the environmental regulation of type III secretion system T3SS through regulated proteolysis of small histone-like protein YmoA
-
-
?
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
2',3'-dialdehyde-ATP
-
i.e. adenosine 2',3'-dialdehyde triphosphate, in the presence of ATP, globin as substrate
3,4-dichloroisocoumarin
-
-
Acetyl-Gly-Gly-Ala chloromethyl ketone
-
-
adenosine 5'-(3-thiotriphosphate)
-
i.e. ATP-gamma-S, in the presence of ATP, globin as substrate
Adenosine 5'-(betathio)triphosphate
-
-
adenosine 5'-[beta,gamma-imido]triphosphate
-
protein and ATP hydrolysis
adenyl-5'-yl methylene diphosphonate
-
i.e. AMP-PCP
Ala-Lys-Arg chloromethyl ketone
-
weak, casein as substrate
alpha,beta-methylene-ATP
-
in the presence of ATP, globin as substrate
anti-sense morpholino oligonucleotide
-
causes defects in mitochondrial membrane potential, respiration and morphology, as well as apoptotic cell death
-
bacteriophage T4 PinA protein
-
Bacteriophage T4 protease inhibitor PinA
-
-
-
Benzoyl-Arg-Gly-Phe-methoxynaphthylamide
-
-
Benzoyl-Arg-Gly-Phe-Phe-Leu-methoxynaphthylamide
-
glutaryl-Ala-Ala-Phe-methoxynaphthylamide or casein as substrate
benzyloxycarbonyl-Gly-Leu-Phe chloromethyl ketone
benzyloxycarbonyl-Gly-Leu-Pro chloromethyl ketone
-
-
Benzyloxycarbonyl-Gly-NH-C6H4SO2-Phe
-
weak
benzyloxycarbonyl-Phe chloromethyl ketone
cardiolipin
-
cardiolipin-containing liposomes specifically inhibit both the proteolytic and ATPase activities of Lon in a dose-dependent manner. Cardiolipin-containing liposomes selectively bind to Lon. The interaction between cardiolipin-containing liposomes and Lon changes with the order of addition of Mg2+/ATP. When cardiolipin-containing liposomes are added after the addition of Mg2+/ATP to Lon, the binding of cardiolipin-containing liposomes to Lon is significantly decreased as compared with the reversed order
Cb2-Leu-Leu-Leu-aldehyde
-
-
clasto-lactacystin beta-lactone
Dansyl fluoride
-
protein and ATP hydrolysis
dansyl-YRGIT-Abu
-
not time-dependent inhibitor of peptide hydrolysis activity of lon
Denatured lambda Cro protein
-
casein as substrate
-
diisopropyl fluorophosphate
dimethylformamide
-
above 5%
Dimethylsulfoxide
-
above 5%
Dio-9
-
ATPase inhibitor
-
ethylenediaminetetraacetic acid
-
-
Glutaryl-Ala-Ala-Phe
-
ATP hydrolysis
Glutaryl-Ala-Ala-Phe-methoxynaphthylamide
H2O2
-
blocks enzymatic activity but has no appreciable effect on sequence-specific binding to DNA. 0.1 mM decreases proteolytic activity to ca. 60%, at 0.5, 1, and 4 mM protease activity is reduced to 18, 9, and 5%, respectively
isopropylboronic acid
-
-
lambda-N-Protein
-
casein as substrate
-
Mersalyl acid
-
strong, 5 mM, casein as substrate
MG 262
-
is a potent peptide-based inhibitor
Mg2+
excess of magnesium ions has an inhibitory effect on the hydrolysis of ATP
N,N'-dicyclohexylcarbodiimide
p-nitroanthranilate
-
weak
Peptide substrates
-
inhibit ATP hydrolysis, protein substrates promote ATP hydrolysis
-
peroxynitrite
-
in isolated nonsynaptic brain mitochondria Lon protease is highly susceptible to oxidative inactivation by peroxynitrite. This susceptibility is more pronounced with regard to ATP-stimulated activity, which is inhibited by 75% in the presence of a bolus addition of 1 mM ONOO, whereas basal unstimulated activity is inhibited by 45%. A decline in Lon protease activity precedes electron transport chain dysfunction and ATP-stimulated activity is approximately fivefold more sensitive than basal Lon protease activity. Supplementation of mitochondrial matrix extracts with reduced glutathione, following peroxynitrite exposure, results in partial restoration of basal and ATP-stimulated activity
phenylmethylsulfonyl fluoride
Protein R9 from Escherichia coli mutant strain capR9
-
protein, peptide and ATP hydrolysis
-
Succinyl-Phe-Ala-Phe-methoxynaphthylamide
-
ATP hydrolysis
TorD
-
impairs the enzyme's TorA degradation activity by binding to apoTorA
-
tosyl-Lys chloromethyl ketone
tosyl-Phe chloromethyl ketone
ADP
-
protein and ATP hydrolysis
ADP
-
prevents activation by ATP
ADP
-
prevents activation by ATP; strong
ADP
-
prevents activation by ATP; prevents activation by diphosphate
ADP
-
ADP-binding in the presence of EDTA; kinetics; product inhibition
ADP
-
ADP-release is rate-limiting step; binds 4 mol ADP per enzyme tetramer
ADP
-
inhibits proteolytic activity of lon
ADP
non-competitive inhibition, ELon binds to ADP and undergoes at least one structural change that exposes a tryptic digestion site
ADP
free ADP inhibits all forms of Ec-Lon, while a complex of ADP with magnesium ions (ADP-Mg) activates C-His-Lon and Lon-R164A and inhibits the mutant forms Lon R192A and Lon-Y294A
ADP
non-competitive inhibition dependent on substrate concentration, steady-state ADP inhibition study, overview. hLon binds to ADP and undergoes at least one structural change that exposes a tryptic digestion site
ADP
moderate inhibition of 36%
ADP
-
wild-type, up to 60% inhibition, mutant K63A, slight activation, mutants D241A, N293A, R375A, about 50% inhibition of peptidase activity. Complete inhibition of hydrolysis of FITC
AMP
-
in the presence of ATP
ATP
-
-
ATP
-
inhibits binding of enzyme to DNA or RNA
ATP
-
inhibits DNA binding by lon
ATP
-
ATP-binding inhibits DNA binding
ATP
-
substrate inhibition of wild-type and mutant enzymes, kinetics, overview
ATP
-
peptidase activity of enzyme is modulated by the ATP-state of the AAA+ domain. Absence of nucleotide results in basal activity, presence of ATP reduces the basal activity. Presence of ATP stimulates hydrolysis of FITC 10fold
bacteriophage T4 PinA protein
-
inhibits degradation of alpha-methyl-casein and CcdA, noncompetitive inhibition, no inhibition of cleavage of N-glutaryl-alanylalanylphenylalanyl-3-methoxynaphthylamide
-
bacteriophage T4 PinA protein
-
specifically inhibits Escherichia coli Lon
-
benzyloxycarbonyl-Gly-Leu-Phe chloromethyl ketone
-
strong
benzyloxycarbonyl-Gly-Leu-Phe chloromethyl ketone
-
-
benzyloxycarbonyl-Phe chloromethyl ketone
-
weak
benzyloxycarbonyl-Phe chloromethyl ketone
-
-
beta,gamma-methylene-ATP
-
not
beta,gamma-methylene-ATP
-
in the presence of ATP, globin as substrate
bortezomib
-
-
bortezomib
enzyme-bound structure analysis
chymostatin
-
weak
chymostatin
-
not (casein as substrate)
clasto-lactacystin beta-lactone
-
blocks lon-mediated degradation of steroidogenic acute regulatory protein or FITC casein
clasto-lactacystin beta-lactone
-
-
dansyl-YRGIT-Abu-B(OH)2
-
i.e. DBN93, site-directed peptide inhibitor with two-step mechanism
dansyl-YRGIT-Abu-B(OH)2
-
potent time-dependent inhibitor of peptide hydrolysis activity of lon, inhibition requires the binding but not hydrolysis of ATP, is an alternative peptidyl boronate inhibitor
diisopropyl fluorophosphate
-
protein and ATP hydrolysis
diisopropyl fluorophosphate
-
-
diisopropyl fluorophosphate
-
E. coli
diisopropyl fluorophosphate
-
10 mM, casein as substrate
diisopropyl fluorophosphate
-
-
diisopropyl fluorophosphate
-
inhibition indicates that the enzyme is a serine protease
diisopropyl fluorophosphate
-
-
EDTA
-
casein as substrate; strong
Glutaryl-Ala-Ala-Phe-methoxynaphthylamide
-
weak, casein as substrate
Glutaryl-Ala-Ala-Phe-methoxynaphthylamide
-
ATP-hydrolysis
iodoacetamide
-
at high concentration, protein and ATP-hydrolysis
iodoacetamide
-
10 mM, casein as substrate
MG132
-
blocks lon-mediated degradation of steroidogenic acute regulatory protein or FITC casein
MG132
-
causes calpain 10 accumulation in vivo
MG262
-
-
MG262
-
most potent inhibitor, requires binding, but not hydrolysis, of ATP to initiate inhibition
MG262
-
potent time-dependent inhibitor of peptide hydrolysis activity of lon, inhibition requires the binding but not hydrolysis of ATP
MG262
-
i.e. Cb2-Leu-Leu-Leu-bornic acid
N,N'-dicyclohexylcarbodiimide
-
not
N,N'-dicyclohexylcarbodiimide
-
weak
N-ethylmaleimide
-
-
N-ethylmaleimide
-
not (casein as substrate)
N-ethylmaleimide
-
1 mM, strong; high sensitivity to N-ethylmaleimide (NEM) points to an essential role of sulfhydryl groups in the enzyme activity
N-ethylmaleimide
-
enzyme particularly sensitive to, pointing to an essential role of sulfllydryl groups in enzymatic activity
N-ethylmaleimide
-
the candidate for the NEM binding could be Cys406 located close to the ATP binding site (Gly409-Ser417) and highly conserved between Lon proteases
NaCl
-
at high concentrations
oligomycin
-
weak
phenylmethylsulfonyl fluoride
-
inhibition indicates that the enzyme is a serine protease
phenylmethylsulfonyl fluoride
-
-
PMSF
-
-
PMSF
-
1 mM, casein as substrate
PMSF
-
inhibition of the yeast enzyme activity by PMSF indicates that, the enzyme is also a serine protease
Polyphosphate
-
competitively blocks DNA binding by lon in vitro and in vivo
Polyphosphate
-
slightly inhibits degradation of a maltose-binding protein-SulA fusion. At the ATP domain competes with DNA for binding to lon, completely inhibits the formation of a DNA-lon complex
quercetin
-
-
RNAi
-
-
-
RNAi
-
lon depletion, cells show little if any mitochondrial DNA damage
-
RNAi
-
knockdown of lon
-
tosyl-Lys chloromethyl ketone
-
i.e. 1-chloro-3-tosylamido-2-heptanone; weak, casein as substrate, no inhibition with glutaryl-Ala-Ala-Phe methoxynaphthylamide as substrate
tosyl-Lys chloromethyl ketone
-
weak, casein as substrate, no inhibition with glutaryl-Ala-Ala-Phe methoxynaphthylamide as substrate
tosyl-Lys chloromethyl ketone
-
not (casein as substrate)
tosyl-Phe chloromethyl ketone
-
i.e. tosyl-2-phenylethyl chloromethyl ketone
tosyl-Phe chloromethyl ketone
-
-
tosyl-Phe chloromethyl ketone
-
not (casein as substrate)
vanadate
-
casein and ATP hydrolysis
vanadate
-
ATPase inhibitor; does not inhibit but even stimulates peptide hydrolysis; inhibits protein hydrolysis
vanadate
-
decavanadate (not orthovanadate)
vanadate
-
0.1 mM; casein as substrate
vanadate
-
activity of the yeast protease is sensitive to vanadate, a potent inhibitor of many ATPases
additional information
-
termination factor rho or NaN3
-
additional information
-
methoxynaphthylamide (ATP-hydrolysis)
-
additional information
-
casein (with peptides as substrates)
-
additional information
-
high-affinity site of lon can be blocked with unlabeled nucleotide, conformational change associated with nucleotide binding
-
additional information
-
inhibition of activity by the T4-encoded PinA protein, non-competetive inhibitor
-
additional information
-
lon protease expression and activity declines with age
-
additional information
-
expression of an inducible short hairpin RNA leading to lon depletion in a colon adenocarcinoma cell line for 14 days does not lead to cell death. Even after RNAi knockdown for 3 weeks, these cells continue to survive, although they no longer proliferate
-
additional information
-
not inhibited by epoxomicin
-
additional information
-
binding structure of inhibitors, substrate-binding groove with covalently bound inhibitors, two peptidomimetics and one derived from a natural product, structural basis of inhibitor recognition, overview
-
additional information
-
Lon protease expression and activity declines with age, steady-state levels of lon mRNA are ca. 4fold lower in 30-month-old mice than in young mice. 5fold decrease in protein levels and activity in old mice compared to young mice
-
additional information
-
no inhibition by ubiquitin, bestatin, soybean trypsin inhibitor, aprotinin, leupeptin
-
additional information
-
total activity of lon decreases about 2.5fold in old liver, protein level does not change in old compared to young liver
-
additional information
-
epoxomicin, ZL3-VS and ethylboronic acid are ineffective at inhibiting lon at micromolar concentrations
-
additional information
-
inhibitory profile corresponds to those of ATP-dependent serine proteases of Lon (La) family. Properties compared with ATP-dependent proteases from different sources
-
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Adenosine 2',3'-dialdehyde triphosphate
-
activation, hydrolysis at 23% the rate of ATP, supports proteolysis with 30% the efficiency of ATP
adenosine 5'-(3-thiotriphosphate)
Adenosine 5'-(alpha-thio)triphosphate
-
activation, Rp-diastereoisomer stimulates peptide hydrolysis much more effectively than Sp-diastereoisomer
adenosine-5'-(beta,gamma-imido)triphosphate
-
slight activation
Adenyl-5'-yl imidodiphosphate
adenyl-5'-yl methylene diphosphonate
adenyl-5'-yl methylene monophosphonate
-
i.e. AMP-CPP, activation, competes for the two ATP-high affinity sites
adenylyl 5-imidodiphosphate
-
supports peptide hydrolysis by lon
alpha-casein
-
activates the enzyme
-
Bovine glucagon
-
activation, glutaryl-Ala-Ala-Phe methoxynaphthylamide hydrolysis, with or without ATP, not casein hydrolysis
degron
-
degron binding to this site is not required for proteolysis of sul20-tagged substrates in vitro but enhances degradation by allosterically activating protease activity. Sul20 degron from the cell-division inhibitor SulA binds to the N domain of the enzyme, determination of the recognition site, overview. Allosteric role for the sul20-binding site in the N domain
-
Denatured albumin
-
activation, ATP hydrolysis
-
Denatured bovine serum albumin
-
Denatured calf thymus or E. coli DNA
-
stimulation of glutaryl-Ala-Ala-Phe-methoxynaphthylamide hydrolysis
-
Denatured immunoglobin G
-
Dimethylsulfoxide
-
activation
gentamicin
-
induces lon protease by subinhibitory concentrations
Polyethylene glycol
-
activation
single stranded DNA
-
ATP and protein hydrolysis
spermidine
-
activation, at physiological concentration, ATP hydrolysis and protease activity
tert-butyl hydroperoxide
-
activation is inhibited by MG132
tobramycin
-
induces lon protease by subinhibitory concentrations
adenosine 5'-(3-thiotriphosphate)
-
i.e. adenosine 5'-O-(thiotriphosphate) or ATP-gamma-S, activation
adenosine 5'-(3-thiotriphosphate)
-
equally effective as ATP with casein as substrate
adenosine 5'-(3-thiotriphosphate)
-
hydrolysis, peptide not protein hydrolysis
adenosine 5'-(3-thiotriphosphate)
-
not bovine serum albumin hydrolysis
adenosine 5'-(3-thiotriphosphate)
-
activates, hydrolysis of casein or glutaryl-Ala-Ala-Phe-methoxynaphthylamide
adenosine 5'-(3-thiotriphosphate)
-
slight
Adenyl-5'-yl imidodiphosphate
-
can replace ATP
Adenyl-5'-yl imidodiphosphate
-
casein or glutaryl-Ala-Ala-Phe-methoxynaphthylamide hydrolysis
Adenyl-5'-yl imidodiphosphate
-
i.e. AMP-PNP, activation
Adenyl-5'-yl imidodiphosphate
-
competes for one of the ATP-high-affinity binding-sites
Adenyl-5'-yl imidodiphosphate
-
binding is stimulated by protein substrates
Adenyl-5'-yl imidodiphosphate
-
peptide hydrolysis
Adenyl-5'-yl imidodiphosphate
-
no activation of bovine serum albumin hydrolysis
adenyl-5'-yl methylene diphosphonate
-
i.e. AMP-PCP, activation
adenyl-5'-yl methylene diphosphonate
-
can replace ATP
adenyl-5'-yl methylene diphosphonate
-
casein or glutaryl-Ala-Ala-Phe-methoxynaphthylamide hydrolysis
ATP
-
ATP
-
activates the enzyme activity
ATP
-
human mitochondrial lon degrades mouse StAR in the presence of ATP, but not in its absence
ATP
-
enzyme does not exhibit any proteolytic activity in the presence of ADP or AMPPCP, a nonhydrolyzable ATP analog
ATP
-
hydrolysis of FITC casein is 10fold increase in presence of ATP
ATP
-
enzyme needs ATP for its activity and stability. Properties compared with ATP-dependent proteases from different sources
casein
-
activation, glutaryl-Ala-Ala-Phe-methoxynaphthylamide or insulin B-chain hydrolysis, in the absence of ATP and synergistic with ATP
Denatured bovine serum albumin
-
activation
-
Denatured bovine serum albumin
-
glutaryl-Ala-Ala-Phe methoxynaphthylamide hydrolysis, with or without ATP
-
Denatured immunoglobin G
-
activation
-
Denatured immunoglobin G
-
peptide hydrolysis, with or without ATP
-
DNA
-
activates the enzyme activity
DNA
Escherichia coli Lon binds both single stranded DNA (ssDNA) and RNA (ssRNA), and double stranded DNA (dsDNA) in a non-specific manner, and this interaction enhances Lon ATPase and proteolytic activities
Globin
-
ATP hydrolysis
-
Globin
-
activation, peptide hydrolysis
-
GTP
-
activation
GTP
-
less efficient than ATP
GTP
-
hydrolysis at 113% the rate of ATP, supports proteolysis with 14% the efficiency of ATP
H2O2
-
-
H2O2
-
activation is not inhibited by MG132
Polyphosphate
-
changes substrate preference of enzyme and its oligomeric structure
Polyphosphate
-
upon binding to a site in the ATPase domain, stimulation of degradation of ribosomal protein and inhibition of DNA-enzyme complex formation
Polyphosphate
-
forms a complex with lon, which enables lon to degrade free ribosomal proteins. Polyphosphate with a shorter chain length is less potent in stimulating. Polyphosphate-binding site is within the ATPase domain fo lon between amino acids 320 and 437
Polyphosphate
-
its binding within the ATPase domain of lon promotes the specific association and degradation of free ribosomal proteins
Polyphosphate
-
stimulates lon proteolytic activity, affects substrate preference and oligomeric state of the enzyme
Polyphosphate
-
stimulates lon-mediated proteolysis of free ribosomal proteins and thereby down-regulates translation
Protein substrates
-
activation
-
Protein substrates
-
promotion of ATP hydrolysis
-
Protein substrates
-
stimulation of ATP hydrolysis triggers activation of the proteolytic function
-
Protein substrates
-
rise in ATPase activity proportional to peptide bonds cleaved
-
Protein substrates
-
protein substrates, e.g. denatured bovine serum albumin induce ADP-release and promote ATP-ADP-exchange
-
Protein substrates
-
protein substrates enhance additively the stimulating effect of ATP on peptide hydrolysis and even in the absence of ATP they enhance the ability to degrade fluorogenic tripeptides
-
additional information
-
lonA gene is induced by heat and salt, lonB is not stress-induced
-
additional information
-
enzyme hydroylzes proteins and ATP in a coupled process
-
additional information
-
nonhydrolyzable ATP-analogs are much less effective than ATP in supporting hydrolysis of large proteins
-
additional information
-
no activation by ubiquitin
-
additional information
-
no activation by mRNA, tRNA, poly(rA), (dT)10
-
additional information
-
lon gene is not heat shock-induced
-
additional information
-
enzyme hydroylzes proteins and ATP in a coupled process
-
additional information
-
enzyme hydroylzes proteins and ATP in a coupled process
-
additional information
-
peptide substrates, e.g. glutaryl-Ala-Phe-Phe methoxynaphthylamide or succinyl-Phe-Leu-Phe methoxynaphthylamide do not support ATP hydrolysis
-
additional information
-
no activation by benzoyl-Arg-Gly-Phe-Phe-Leu methoxynaphthylamide (glutaryl-Ala-Ala-Phe methoxynaphthylamide as substrate), poly(A)
-
additional information
-
no activation by nonhydrolyzable proteins, e.g. native or denatured ribonuclease or lysozyme
-
additional information
-
polyphosphate (n:17)
-
additional information
-
nonhydrolyzable ATP-analogs are much less effective than ATP in supporting hydrolysis of large proteins
-
additional information
-
no activation by ubiquitin
-
additional information
-
no activation by ubiquitin
-
additional information
-
protein degradation requires nucleoside triphosphate hydrolysis, cleavage of small peptides only requires binding of nucleotides to the enzyme
-
additional information
-
ATP cannot be replaced by adenosine 5'-(beta-thiotriphosphate)
-
additional information
-
no activation by mRNA, tRNA, poly(rA), (dT)10
-
additional information
-
ATP cannot be replaced by ADP, AMP
-
additional information
-
ATP cannot be replaced by ADP, AMP
-
additional information
-
degradation of proteins stimulates ATPase activity of lon
-
additional information
-
lon gene is heat shock-induced
-
additional information
-
the enzyme activity of Lon can be stimulated by the presence of unfolded proteins (e.g. apomyoglobin, glucagon, and alpha-casein) as well as inorganic polyphosphate accumulated during amino acid starvation
-
additional information
-
protein substrate stimulates DNA binding
-
additional information
-
both ATPase and peptidase activities can be stimulated by the binding of a larger protein substrate, such as beta-casein
-
additional information
binding of protein substrates by Lon stimulates its ATPase and peptidase activities and that this activation is likely to be allosteric
-
additional information
-
binding of protein substrates by Lon stimulates its ATPase and peptidase activities and that this activation is likely to be allosteric
-
additional information
substrate binding stimulates the enzyme's ATPase activity, 1.37 to 2.39fold, overview
-
additional information
-
substrate binding stimulates the enzyme's ATPase activity, 1.37 to 2.39fold, overview
-
additional information
magnesium-dependent activation and hexamerization of the Lon AAA+ protease
-
additional information
-
stimulation of ATPase activity by substrates
-
additional information
-
stimulated by unfolded protein and supported by nonhydrolyzed nucleotide analogs
-
additional information
-
stimulated by unfolded protein and supported by nonhydrolyzed nucleotide analogs>
-
additional information
-
oligomerization is stimulated by unfolded protein
-
additional information
-
enzyme hydroylzes proteins and ATP in a coupled process
-
additional information
-
nonhydrolyzable ATP-analogs are much less effective than ATP in supporting hydrolysis of large proteins
-
additional information
-
no activation by ubiquitin
-
additional information
-
no activation by mRNA, tRNA, poly(rA), (dT)10
-
additional information
-
lon gene is not heat shock-induced
-
additional information
-
expression of lon increases over time when bacteria are grown in subinhibitory ciprofloxacin concentrations. Subinhibitory antibiotic environments contribute to the development of resistance
-
additional information
-
enzyme hydroylzes proteins and ATP in a coupled process
-
additional information
-
nonhydrolyzable ATP-analogs are much less effective than ATP in supporting hydrolysis of large proteins
-
additional information
-
no activation by ubiquitin
-
additional information
-
no activation by ubiquitin
-
additional information
-
ATP cannot be replaced by nucleoside diphosphates, nucleoside monophosphates, 5'-adenylyl-betagamma-methylene diphosphate, NADP+, NAD+
-
additional information
-
no activation by mRNA, tRNA, poly(rA), (dT)10
-
additional information
-
in heart mitochondria, lon expression increases with age, its ATP-stimulated activity remains the same in young and old cells
-
additional information
-
enzyme hydroylzes proteins and ATP in a coupled process
-
additional information
-
nonhydrolyzable ATP-analogs are much less effective than ATP in supporting hydrolysis of large proteins
-
additional information
-
no activation by ubiquitin
-
additional information
-
no activation by mRNA, tRNA, poly(rA), (dT)10
-
additional information
-
activity of yeast lon alpha-proteolytic fragment enhanced when it is coexpressed with a construct containing the N- and A-domains (residues 1-917)
-
additional information
substrate binding stimulates the enzyme's ATPase activity
-
additional information
-
substrate binding stimulates the enzyme's ATPase activity
-
additional information
-
lon gene is heat shock-induced
-
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
evolution
although Lon is originally identified as an ATP-dependent protease with fused AAA+ (ATPases associated with diverse cellular activities) and protease domains, analyses have recently identified LonC as a class of Lon-like proteases with no intrinsic ATPase activity. In contrast to the canonical ATP-dependent Lon present in eukaryotic organelles and prokaryotes, LonC contains an AAA-like domain that lacks the conserved ATPase motifs
evolution
-
evolution has diversified rather than optimized the protein unfolding activities of different AAA+ proteases, Escherichia coli utilizes five different AAA+ proteases: Lon, ClpXP, ClpAP, HslUV, and FtsH
evolution
-
homooligomeric ATP-dependent LonA proteases are bifunctional enzymes belonging to the superfamily of AAA+ proteins
evolution
the enzyme is a member of the ATP-dependent protease family
evolution
-
the enzyme is a member of the ATPase superfamily
evolution
human enzyme hLon and Escherichia coli enzyme ELon bind to ADP and undergo at least one structural change that exposes the same tryptic digestion site, suggesting the presence of at least one conserved structural change in the two enzyme homologues upon binding to ADP
evolution
human enzyme hLon and Escherichia coli enzyme ELon bind to ADP and undergo at least one structural change that exposes the same tryptic digestion site, suggesting the presence of at least one conserved structural change in the two enzyme homologues upon binding to ADP
evolution
human Lon (hLon) is a mitochondrial AAA+ protein (ATPases associated with diverse cellular activities) belonging to the LonA protease subfamily
evolution
Lon is a highly conserved member of the AAA+ (ATPases associated with diverse cellular activities) protease family
evolution
Lon proteases can be divided into two subfamilies: LonA (found in eubacteria and eukarya) and LonB (found in archaea). LonA proteases are formed by three functional domains: the N-terminal, involved in substrate binding, the central AAA+ domain, and the C-terminal domain (named P domain), which containing the Ser-Lys catalytic dyad for proteolytic activity. LonB proteases are composed by an ATPase and a protease domain and a hydrophobic transmembrane region which anchors the protein to the internal face of cell membrane
evolution
Lon proteases can be divided into two subfamilies: LonA (found in eubacteria and eukarya) and LonB (found in archaea). LonA proteases are formed by three functional domains: the N-terminal, involved in substrate binding, the central AAA+ domain, and the C-terminal domain (named P domain), which containing the Ser-Lys catalytic dyad for proteolytic activity. LonB proteases are composed by an ATPase and a protease domain and a hydrophobic transmembrane region which anchors the protein to the internal face of cell membrane
evolution
Lon proteases can be divided into two subfamilies: LonA (found in eubacteria and eukarya) and LonB (found in archaea). LonA proteases are formed by three functional domains: the N-terminal, involved in substrate binding, the central AAA+ domain, and the C-terminal domain (named P domain), which containing the Ser-Lys catalytic dyad for proteolytic activity. LonB proteases are composed by an ATPase and a protease domain and a hydrophobic transmembrane region which anchors the protein to the internal face of cell membrane. In eukarya, two Lon proteases are present: a mitochondrial and a peroxisomal form, encoded by two different genes
evolution
Lon proteases can be divided into two subfamilies: LonA (found in eubacteria and eukarya) and LonB (found in archaea). LonA proteases are formed by three functional domains: the N-terminal, involved in substrate binding, the central AAA+ domain, and the C-terminal domain (named P domain), which containing the Ser-Lys catalytic dyad for proteolytic activity. LonB proteases are composed by an ATPase and a protease domain and a hydrophobic transmembrane region which anchors the protein to the internal face of cell membrane. In eukarya, two Lon proteases are present: a mitochondrial and a peroxisomal form, encoded by two different genes
evolution
Lon proteases can be divided into two subfamilies: LonA (found in eubacteria and eukarya) and LonB (found in archaea). LonA proteases are formed by three functional domains: the N-terminal, involved in substrate binding, the central AAA+ domain, and the C-terminal domain (named P domain), which containing the Ser-Lys catalytic dyad for proteolytic activity. LonB proteases are composed by an ATPase and a protease domain and a hydrophobic transmembrane region which anchors the protein to the internal face of cell membrane. In eukarya, two Lon proteases are present: a mitochondrial and a peroxisomal form, encoded by two different genes
evolution
LonA from Escherichia coli belongs to the superfamily of AAA+ proteins, family S16 of proteases. The presence of an extended variable N-terminal region preceding the AAA+ modules is a characteristic feature of LonA proteases distinguishing them from other AAA+ proteins
evolution
phylogenetic analysis reveals that Lon-like-Ms and its homologs are members of the Lon family. The ATP-dependent Lon (La) protease is the most highly conserved member of the energy-dependent protease present in the cytosol of prokaryotes and in the mitochondria and peroxisomes of eukaryotes. While the LonA group is found in eukaryotes and bacteria, the LonB subfamily proteins are only found in archaea. Two genes (Msm 1569 and Msm 1754) encoding Lon occur in the genome sequence, and the encoded proteins may play different roles. Msm 1569 encodes a canonical LonB protease (Lon-Ms). Msm 1754 (Lon-like-Ms) differs considerably from previously reported Lon proteases
evolution
-
structural comparison of AAA+ modules between LonA and LonB reveals that the AAA+ modules of Lon proteases are separated into two distinct clades depending on their structural features. The H2-insert clade is characterized by the presence of both the PS-1 insertion and the H2 insertion. In the H2-insert clade, no member has an additional insertion, like Ins1, between alpha4 and beta2 in the RFC-B AAA+ module. Therefore, it is not appropriate to classify the AAA+ module of TonLonB as the H2-insert clade. Alternatively, the AAA+ module of LonB belongs to a new clade, named H2 & Ins1 insert clade is proposed. The AAA+ module of LonB belongs to the H2 & Ins1 insert clade (HINS clade), while the AAA+ module of LonA is a member of the HCLR clade
evolution
the enzyme belongs to the protease family S16 and to the superfamily of AAA+ proteins
evolution
the enzyme belongs to the protease fasmily S16
evolution
-
the enzyme is a member of the ATP-dependent protease family
-
evolution
-
phylogenetic analysis reveals that Lon-like-Ms and its homologs are members of the Lon family. The ATP-dependent Lon (La) protease is the most highly conserved member of the energy-dependent protease present in the cytosol of prokaryotes and in the mitochondria and peroxisomes of eukaryotes. While the LonA group is found in eukaryotes and bacteria, the LonB subfamily proteins are only found in archaea. Two genes (Msm 1569 and Msm 1754) encoding Lon occur in the genome sequence, and the encoded proteins may play different roles. Msm 1569 encodes a canonical LonB protease (Lon-Ms). Msm 1754 (Lon-like-Ms) differs considerably from previously reported Lon proteases
-
evolution
-
Lon proteases can be divided into two subfamilies: LonA (found in eubacteria and eukarya) and LonB (found in archaea). LonA proteases are formed by three functional domains: the N-terminal, involved in substrate binding, the central AAA+ domain, and the C-terminal domain (named P domain), which containing the Ser-Lys catalytic dyad for proteolytic activity. LonB proteases are composed by an ATPase and a protease domain and a hydrophobic transmembrane region which anchors the protein to the internal face of cell membrane. In eukarya, two Lon proteases are present: a mitochondrial and a peroxisomal form, encoded by two different genes
-
malfunction
-
Hvlon can be deleted from the chromosome only when a copy of the wild type gene is provided in trans suggesting that Lon is essential for survival in this archaeon. The contents of bacterioruberins and some polar lipids were increased in the lon mutants suggesting that Lon is linked to maintenance of membrane lipid balance which likely affects cell viability in this archaeon
malfunction
-
altered expression levels of the enzyme are linked to some severe diseases such as epilepsy, myopathy, or lateral sclerosis
malfunction
homozygous deletion of Lonp1 causes early embryonic lethality, whereas its haploinsufficiency protects against colorectal and skin tumors. LONP1 knockdown inhibits cellular proliferation and tumor and metastasis formation, phenotypes, overview. LONP1 is necessary for proliferation and metastasis of melanoma cells
malfunction
in a lon mutant, the steady-state levels and the stability of the GacA protein are significantly elevated at the end of exponential growth, the expression of the sRNAs RsmY and RsmZ and that of dependent physiological functions such as antibiotic production are significantly enhanced. In starved cells, the loss of Lon function prolonged the half-life of the GacA protein. The lon mutant has a higher biocontrol activity per viable cell, but this positive effect appears to be compromised by a reduced fitness of the mutant in the rhizosphere on cucumber. Biocontrol of Pythium ultimum on cucumber roots requires fewer lon mutant cells than wild-type cells. In starved cells, the loss of Lon function prolonges the half-life of the GacA protein. The lon mutant exhibits increased aprA expression and antibiotic activity
malfunction
-
lon mutants are supersusceptible to ciprofloxacin, and exhibit a defect in cell division and in virulence-related properties, such as swarming, twitching and biofilm formation, despite the fact that the Lon protease is not a traditional regulator. The lon mutant has a defect in cytotoxicity towards epithelial cells, is less virulent in an amoeba model as well as a mouse acute lung infection model, and is impacted on in vivo survival in a rat model of chronic infection. The lon mutation leads to a downregulation of Type III secretion genes. The Lon protease also influenced motility and biofilm formation in a mucin-rich environment, defective virulence in vivo. Phenotype detailed overview
malfunction
-
overexpression of the enzyme increases tumorigenesis, high levels of LONP1 are a poor prognosis marker in human colorectal cancer and melanoma, phenotypes, overview
malfunction
the stem nodules in the host legume Sesbania rostrata formed by the lon mutant show little or no nitrogen fixation activity. The reb genes are highly expressed in the lon mutant, high expression of reb genes in part causes aberrance in the Azorhizobium caulinodans-Sesbania rostrata symbiosis
malfunction
a Lon trapping variant, which is able to translocate substrates but unable to degrade them, is established and used for substrate determinations by mass spectrometry
malfunction
altered expression levels of the human mitochondrial Lon protease (hLon) are linked to serious diseases including myopathies, paraplegia, and cancer. The enzymatic activities and the 3D structure of a hLon mutant lacking the first 156 amino acids are severely disturbed
malfunction
-
deletion of Lon's ATPase domain abrogates interactions with DNA. Substitution of positively charged amino acids in this domain in full-length Lon with residues conferring a net negative charge disrupts binding of Lon to DNA. These changes also affect the degradation of nucleic acid binding protein substrates of Lon, intracellular localization of Lon, and cell morphology. The DNA-binding defect of Lon protease affects plasmid replication initiator protein TrfA proteolysis. And the Lon mutants are defective in proper cellular localization, most probably due to their impaired ability to form a nucleoprotein complex. The phenotype of the DNA binding-defective Lon mutants is similar to that observed for Lon-deficient strains
malfunction
downregulation leads to increased starvation-induced autophagy, and accumulation of PTEN-induced putative kinase-1 (PINK1), an essential regulator of mitophagy. Enzyme Lon is involved in genetic diseases and Lon protease plays a crucial role in the process of cell adaptation to a hypoxic environment, overview. Hypoxia leads to Lon upregulation in several cell types in humans, including monocytic acute myelogeneous leukaemia (THP-1), cardiomyocytes, embryonic kidney (293T) cells, rhabdomyosarcoma cells, renal cell carcinoma (RCC4) stably expressing Von Hippel-Lindau protein (VHL)
malfunction
enzyme knockout is embryonically lethal in mice. Lon+/- mouse model, in which the expression of Lon is halved, is characterized by a lower tendency to develop cancer and a higher resistance to carcinogenic compounds than wild type counterparts. Accordingly, growth of Lon-silenced cancer cells in xenograft model is significantly reduced if compared to control cells, while cells overexpressing Lon grow more rapidly. In vivo, Lon overexpression favours glycolysis, facilitates proliferation, and capability to migrate and form metastasis of melanoma cells in nude mice
malfunction
mutation of the lon gene leads to the overproduction of amylovoran, increased T3SS gene expression and the nonmotile phenotype. Erwinia amylovora depends on the type III secretion system (T3SS) and the exopolysaccharide (EPS) amylovoran to cause disease, and deletion of the lon gene in the csrA mutant only rescues amylovoran production, but not T3SS. RcsA/RcsB accumulation suppresses motility and flhD transcription in the lon mutant. Expression of the csrB sRNA is suppressed by RcsA/RcsB accumulation in the lon mutant
malfunction
removal of the HI(CC) domain results in a dexadcrease in the activity of the peptidase center of the Ec-Lon protease and a loss of the regulatory effect of the ATPase center on the peptidase one, which is defined by the nature of the bound nucleotide in the intact enxadzyme. Deletion of the HI(CC) domain leads to a complete loss of the proteolytic activity towards beta-casein by the deletion form
malfunction
suboptimal LonB expression affects the content of membrane carotenoids and other lipids. Haloferax volcanii mutant cells deficient in Lon content are more sensitive to puromycin compared to wild-type cells. Deregulation of the cellular concentration of bacterioruberins and other lipids affects membrane stability contributing to the lethal phenotype of the lon knockout mutant
malfunction
-
substitution of alanine for Lon serine 654 results in repression of T3SS gene expression in the Citrus host through robust degradation of HrpG and reduced bacterial virulence
malfunction
the deletion form DELTArLon is incapable of hydrolyzing beta-casein in the time interval in which the proteolytic activity of full-length rLon protease is tested
malfunction
the Lon mutant variant V217A/Q220A (LonVQ) forms a dodecamer with increased stability compared to wild-type. Cells expressing only LonVQ are healthier than Lon-deficient strains during normal growth and perform similarly to wild-type Lon in a panel of in vivo bioassays except for degradation of small heat shock proteins. At 37°C, the enzyme-ddeficient DELTAlon strain grows significantly slower than the wild-type strain and never establishes a true exponential phase, but loss of Lon activity is not deleterious to viability
malfunction
-
the wild-type strain shows continuous linear growth for 60 days, whereas growth is impeded at 30 and 50 days for mitochondrial and peroxisomal isozyme-deficient mutants DELTAPLon and DELTAMLon mutants, respectively, suggesting that PLon is more important for longevity than MLon. Conidia production dramatically increases with the PLon deletion strain but not with the MLon deletion strain. Mutant DELTAPLon strains are more sensitive to multiple stressors than DELTAMLon
malfunction
-
suboptimal LonB expression affects the content of membrane carotenoids and other lipids. Haloferax volcanii mutant cells deficient in Lon content are more sensitive to puromycin compared to wild-type cells. Deregulation of the cellular concentration of bacterioruberins and other lipids affects membrane stability contributing to the lethal phenotype of the lon knockout mutant
-
malfunction
-
the stem nodules in the host legume Sesbania rostrata formed by the lon mutant show little or no nitrogen fixation activity. The reb genes are highly expressed in the lon mutant, high expression of reb genes in part causes aberrance in the Azorhizobium caulinodans-Sesbania rostrata symbiosis
-
malfunction
-
in a lon mutant, the steady-state levels and the stability of the GacA protein are significantly elevated at the end of exponential growth, the expression of the sRNAs RsmY and RsmZ and that of dependent physiological functions such as antibiotic production are significantly enhanced. In starved cells, the loss of Lon function prolonged the half-life of the GacA protein. The lon mutant has a higher biocontrol activity per viable cell, but this positive effect appears to be compromised by a reduced fitness of the mutant in the rhizosphere on cucumber. Biocontrol of Pythium ultimum on cucumber roots requires fewer lon mutant cells than wild-type cells. In starved cells, the loss of Lon function prolonges the half-life of the GacA protein. The lon mutant exhibits increased aprA expression and antibiotic activity
-
malfunction
-
suboptimal LonB expression affects the content of membrane carotenoids and other lipids. Haloferax volcanii mutant cells deficient in Lon content are more sensitive to puromycin compared to wild-type cells. Deregulation of the cellular concentration of bacterioruberins and other lipids affects membrane stability contributing to the lethal phenotype of the lon knockout mutant
-
malfunction
-
the wild-type strain shows continuous linear growth for 60 days, whereas growth is impeded at 30 and 50 days for mitochondrial and peroxisomal isozyme-deficient mutants DELTAPLon and DELTAMLon mutants, respectively, suggesting that PLon is more important for longevity than MLon. Conidia production dramatically increases with the PLon deletion strain but not with the MLon deletion strain. Mutant DELTAPLon strains are more sensitive to multiple stressors than DELTAMLon
-
malfunction
-
suboptimal LonB expression affects the content of membrane carotenoids and other lipids. Haloferax volcanii mutant cells deficient in Lon content are more sensitive to puromycin compared to wild-type cells. Deregulation of the cellular concentration of bacterioruberins and other lipids affects membrane stability contributing to the lethal phenotype of the lon knockout mutant
-
malfunction
-
suboptimal LonB expression affects the content of membrane carotenoids and other lipids. Haloferax volcanii mutant cells deficient in Lon content are more sensitive to puromycin compared to wild-type cells. Deregulation of the cellular concentration of bacterioruberins and other lipids affects membrane stability contributing to the lethal phenotype of the lon knockout mutant
-
malfunction
-
mutation of the lon gene leads to the overproduction of amylovoran, increased T3SS gene expression and the nonmotile phenotype. Erwinia amylovora depends on the type III secretion system (T3SS) and the exopolysaccharide (EPS) amylovoran to cause disease, and deletion of the lon gene in the csrA mutant only rescues amylovoran production, but not T3SS. RcsA/RcsB accumulation suppresses motility and flhD transcription in the lon mutant. Expression of the csrB sRNA is suppressed by RcsA/RcsB accumulation in the lon mutant
-
malfunction
-
suboptimal LonB expression affects the content of membrane carotenoids and other lipids. Haloferax volcanii mutant cells deficient in Lon content are more sensitive to puromycin compared to wild-type cells. Deregulation of the cellular concentration of bacterioruberins and other lipids affects membrane stability contributing to the lethal phenotype of the lon knockout mutant
-
malfunction
-
suboptimal LonB expression affects the content of membrane carotenoids and other lipids. Haloferax volcanii mutant cells deficient in Lon content are more sensitive to puromycin compared to wild-type cells. Deregulation of the cellular concentration of bacterioruberins and other lipids affects membrane stability contributing to the lethal phenotype of the lon knockout mutant
-
malfunction
-
suboptimal LonB expression affects the content of membrane carotenoids and other lipids. Haloferax volcanii mutant cells deficient in Lon content are more sensitive to puromycin compared to wild-type cells. Deregulation of the cellular concentration of bacterioruberins and other lipids affects membrane stability contributing to the lethal phenotype of the lon knockout mutant
-
metabolism
-
mitochondrial calpain 10 is selectively degraded by Lon protease under basal conditions and is enhanced under and oxidizing conditions, while cytosolic calpain 10 is degraded by the proteasome
metabolism
-
plant mitochondrial protein carbonylation, an irreversible oxidative protein modification that inactivates the protein function, and role of the ATP-dependent proteases in defending mitochondria against accumulation of carbonylated proteins, overview. In plants, carbonylated proteins are found in virtually all cellular compartments - cytosol, chloroplasts, peroxisomes, nucleus, and mitochondria - and in the entire plant life cycle with especially high levels at certain stages of growth and development. Carbonylated breakdown products of mitochondrial proteins might act as secondary messengers in retrograde signaling from plant mitochondria to the nucleus. mitochondria depend on a series of pathways that continuously monitor and remove oxidatively damaged proteins
metabolism
-
the enzyme has a global impact on the physiology of the euryarchaeon Haloferax volcanii, affecting key cellular processes as well as organism-specific so far unknown functions which may be required for survival/adaptation under extreme conditions
metabolism
a connection between Lon and the GacS/GacACsr regulatory system might exist
metabolism
ATP-dependent Lon protease of Escherichia coli (Ec-Lon) is a key enzyme of the quality control system of the cell proteome
metabolism
functions of Lon protease in human mitochondria, overview. Lon expression highly correlates with expression of heat shock 60 kDa protein-1 (HSPD1), heat shock 10 kDa protein-1 (HSPE1), heat shock 70 kDa protein-9 (HSPA9), and caseinolytic mitochondrial matrix peptidase proteolytic subunit (CLPP), which are all involved in the mitochondrial unfolded protein response (UPRmt)
metabolism
-
the enzyme has a global impact on the physiology of the euryarchaeon Haloferax volcanii, affecting key cellular processes as well as organism-specific so far unknown functions which may be required for survival/adaptation under extreme conditions
-
metabolism
-
a connection between Lon and the GacS/GacACsr regulatory system might exist
-
metabolism
-
mitochondrial calpain 10 is selectively degraded by Lon protease under basal conditions and is enhanced under and oxidizing conditions, while cytosolic calpain 10 is degraded by the proteasome
-
physiological function
a lon2 disruption mutant is mildly resistant to the inhibitory effects of indole-3-butyric acid on root elongation, resistant to the stimulatory effects of indole-3-butyric acid on lateral root production and display succinate dependence during seedling growth. lon2 mutants display defects in removing the type 2 peroxisome targeting signal PTS2 from peroxisomal malate dehydrogenase and reduced accumulation of 3-ketoacyl-CoA thiolase, another PTS2-containing protein, both defects are not apparent upon germination but appear in 5 to 8 days old seedlings. In lon2 cotyledon cells, matrix proteins are localized to peroxisomes in 4 days old seedlings but mislocalized to the cytosol in 8 days old seedlings. A PTS2-green fluorescent protein reporter sorts to peroxisomes in lon2 root tip cells but is largely cytosolic in more mature root cells. LON2 is needed for sustained matrix protein import into peroxisomes
physiological function
-
absence of Lon protease blocks paradoxical survival occurring at very high nalidixic acid concentrations. The absence of Lon also blocks a parallel increase in cell lysate viscosity likely to reflect DNA size
physiological function
-
deletion of genes cpxR and lon results in mutants highly similar to wild-type. In comparison with the wild-type, 1.5- to 3.3fold increases of fimbrial products such as Agf, Fim, and Pef fimbria are observed in the single and double mutants. lon single and cpxR and lon double mutants morphologically appear elongated in shape and produce 2.0- and 3.2fold increases, respectively, of capsular polysaccharide, which is a major antigenic component. Approximately 104fold attenuation assessed by analysis of LD50 of BALB/c mouse is observed by deleting the lon/cpxR genes
physiological function
-
Lon possesses an intrinsic ATPase activity that is stimulated by protein and certain peptide substrates. The ATPase reaction catalyzed by Lon in the presence and absence of peptide substrate that stimulates the enzyme's ATPase activity is irreversible
physiological function
Lon-1 may be important in host adaptation from the arthropod to a warm-blooded host. Recombinant Lon-1 shows properties of an ATP-dependent chaperone protease in vitro but does not complement an Escherichia coli Lon mutant
physiological function
Lon-2 is engaged in cellular homeostasis
physiological function
-
Pim1-mediated proteolysis is required for elimination of oxidatively damaged proteins in mitochondria. Pim1 plays a prevalent role in mitochondrial protein quality control
physiological function
-
the alpha-domain from Lon binds to the duplex nucleotide sequence 5'-CTGTTAGCGGGC-3' from pET28a plasmid DNA sequence map and protects it from DNase I digestion. The Brevibacillus thermoruber Lon alpha-domain binds with 5'-CTGTTAGCGGGC-3' double-stranded DNA tighter than Lon alpha-domains from Escherichia coli and Bacillus subtilis, whereas the Brevibacillus thermoruber Lon alpha-domain has dramatically lower affinity for double-stranded DNA with 0 and 50% identity to the 5'-CTGTTAGCGGGC-3' binding sequence
physiological function
-
the alpha-domain from Lon binds to the duplex nucleotide sequence 5'-CTGTTAGCGGGC-3' from pET28a plasmid DNA sequence map and protects it from DNase I digestion. The Brevibacillus thermoruber Lon alpha-domain binds with 5'-CTGTTAGCGGGC-3' double-stranded DNA tighter than Lon alpha-domains from Escherichia coli and Bacillus subtilis, whereas the Brevibacillus thermoruber Lon alpha-domain has dramatically lower affinity for double-stranded DNA with 0 and 50% identity to the 5'-CTGTTAGCGGGC-3' binding sequence
physiological function
-
the alpha-domain from Lon binds to the duplex nucleotide sequence 5'-CTGTTAGCGGGC-3' from pET28a plasmid DNA sequence map and protects it from DNase I digestion. The Brevibacillus thermoruber Lon alpha-domain binds with 5'-CTGTTAGCGGGC-3' double-stranded DNA tighter than Lon alpha-domains from Escherichia coli and Bacillus subtilis, whereas the Brevibacillus thermoruber Lon alpha-domain has dramatically lower affinity for double-stranded DNA with 0 and 50% identity to the 5'-CTGTTAGCGGGC-3' binding sequence
physiological function
-
the Lon protease is a stress-responsive protein that is induced by multiple stressors, including heat shock, serum starvation, and oxidative stress. Lon induction, by pretreatment with low-level stress, protects against oxidative protein damage, diminished mitochondrial function, and loss of cell proliferation induced by toxic levels of hydrogen peroxide. Blocking Lon induction with Lon siRNA also blocks this induced protection
physiological function
-
the Lon protease and the SecB and DnaJ/Hsp40 chaperones are involved in the quality control of presecretory proteins in Escherichia coli. Mutations in the lon gene alleviate the cold-sensitive phenotype of a secB mutant. In comparison to the respective single mutants, the double secB lon mutant strongly accumulates aggregates of SecB substrates at physiological temperatures, suggesting that the chaperone and the protease share substrates. The main substrates identified in secB lon aggregates, namely proOmpF and proOmpC, are highly sensitive to specific degradation by Lon. In contrast, both substrates are significantly protected from Lon degradation by SecB. The chaperone DnaJ by itself protects substrates better from Lon degradation than SecB or the complete DnaK/DnaJ/GrpE chaperone machinery
physiological function
-
transposon inactivation of ycgE, encoding a putative transcriptional regulator, leads to decreased multidrug susceptibility in an Escherichia coli lon mutant. The multidrug susceptibility phenotype e.g., to tetracycline and beta-lactam antibiotics, requires the inactivation of both lon and ycgE. In this mutant, a decreased amount of OmpF porin contributes to the lowered drug susceptibility, with a greater effect at 26°C than at 37°C
physiological function
lon disruption mutants show increased UV sensitivity, and produce higher levels of tabtoxin than the wild-type. Strains with lon disruption elicit the host defense system more rapidly and strongly than the wild-type strain, suggesting that the Lon protease is essential for systemic pathogenesis
physiological function
-
mitochondrial proteins aggregate to a substantial extent if they are challenged by either heat stress or reactive oxygen. As an important aspect of quality control, the proteolytic activity of Pim1 prevents the accumulation of these aggregation-prone polypeptides, resulting in prevention of proteotoxic effects
physiological function
purified Lon binds double stranded as well as single stranded DNA in the presence of elevated salt concentrations
physiological function
-
reduction of Lon to less than 10% of its normal level in Drosophila Schneider cells by RNAi knockdown results in increased abundance of mitochondrial transcription factor A, TFAM, and mitochondrial DNA copy number. In a corollary manner, overexpression of Lon reduces TFAM levels and mt DNA copy number. Induction of mitochondrial DNA depletion in Lon knockdown cells does not result in degradation of TFAM, thereby causing a dramatic increase in the TFAM:mitochondrial DNA ratio. The increased TFAM:mitochondrial DNA ratio in turn causes inhibition of mitochondrial transcription
physiological function
-
the enzyme controls membrane lipids composition and is essential for viability in the extremophilic haloarchaeon Haloferax volcanii
physiological function
-
AAA+ proteases employ a hexameric ring that harnesses the energy of ATP binding and hydrolysis to unfold native substrates and translocate the unfolded polypeptide into an interior compartment for degradation. Ability of theLon protease to unfold and degrade model protein substrates beginning at N-terminal, C-terminal, or internal degrons, unfolding with robust and processive unfolding/degradation of some substrates with very stable protein domains, including mDHFR and titin, overview
physiological function
ATP-dependent proteases, e.g. represented by Lon, are stress proteins that are induced in bacterial cells in response to unfavourable conditions. The enzyme negatively affects GacA protein stability and expression of the Gac/Rsm signal transduction pathway in Pseudomonas protegens, it is an important negative regulator of the Gac/Rsm signal transduction pathway in the organism. The Gac/Rsm signal transduction pathway controls secondary metabolism and suppression of fungal root pathogens via the expression of regulatory small RNAs, overview
physiological function
-
Lon is an ATPase associated with cellular activities protease that controls cell division in response to stress and also degrades misfolded and damaged proteins
physiological function
Lon protease is required to suppress the expression of the reb genes. Lon protease is also involved in the regulation of exopolysaccharide production and autoagglutination of bacterial cells
physiological function
-
protease Lon eliminates an immature or misfolded molybdoenzyme probably by targeting its inactive catalytic site, it is involved in the apoTorA degradation process
physiological function
-
the ATP-dependent Lon protease is a key component of the quality control system, which ensures the integrity and functionality of cellular proteins
physiological function
-
the enzyme can function as a protease or a chaperone and reveal that some of its ATP-dependent biological activities do not require translocation. Enzyme-mediated relief of proteotoxic stress and protein aggregation in vivo can also occur without degradation but is not dependent on robust ATP hydrolysis. Degron binding regulates the activities of the AAA+ Lon protease in addition to targeting proteins for degradation, degron binding regulates Lon ATPase and protease activity in addition to serving a recognition function. Inactivation of cell-division inhibitor SulA in vivo requires binding to the N domain and robust ATP hydrolysis but does not require degradation or translocation into the proteolytic chamber
physiological function
the enzyme expression in reguated by HtrA2 serine protease, Lon1 protease is overexpressed in HtrA2-deficient cells, phenotype, overview. HtrA2 regulates mitochondrial proteins through its serine protease activity
physiological function
the enzyme expression in reguated by HtrA2 serine protease, Lon1 protease is overexpressed in HtrA2-deficient cells, phenotype, overview. HtrA2 regulates mitochondrial proteins through its serine protease activity
physiological function
-
the enzyme plays a key role in metabolic reprogramming by remodeling OXPHOS complexes and protecting against senescence. The protease is a central regulator of mitochondrial activity in oncogenesis. LONP1 is necessary for proliferation and metastasis of melanoma cells
physiological function
the enzyme plays a key role in metabolic reprogramming by remodeling OXPHOS complexes and protecting against senescence. The protease is a central regulator of mitochondrial activity in oncogenesis. Role of LONP1 in the regulation of mitochondrial function in cancer, overview
physiological function
-
the Lon protease is an ATP-dependent serine protease recognized as a key protease up-regulated under oxidative stress and involved in the removal of oxidized proteins, the mitochondrial inner membrane i-AAA protease is a crucial component of the defense against accumulation of carbonylated proteins. Due to the irreversible and unrepairable nature of protein carbonylation, proteolytic elimination of oxidatively damaged polypeptides is the major process of the mitochondrial protein quality control system under oxidative stress as first line of defense
physiological function
-
the Lon protease is essential for full virulence in Pseudomonas aeruginosa. The Lon protease is not a traditional regulator
physiological function
the Lon-insertion domain of LonC is involved both in Skplike chaperone activity and in recognition of unfolded protein substrates, structure of Lon-insertion domain is remarkably similar to the tentacle-like prong of the periplasmic chaperone Skp
physiological function
-
the main function of the enzyme is the control of protein quality and the maintenance of proteostasis by degradation of misfolded and damaged proteins, which occur in response to numerous stress conditions. It also participates in the regulation of levels of transcription factors that control pathogenesis, development and stress response
physiological function
-
a phosphorylation switch on Lon protease regulates bacterial type III secretion system in the host. Host-induced phosphorylation of the ATP-dependent protease Lon stabilizes HrpG, the master regulator of T3SS, conferring bacterial virulence. In rich medium, Lon represses the type III secretion system (T3SS) by degradation of HrpG via recognition of its N-terminus. Phosphorylation at Ser654 deactivates Lon proteolytic activity and attenuates HrpG proteolysis. Lon protease negatively regulates bacterial virulence by repressing hrc/hrp gene transcription. Phosphorylation of Lon is required for bacterial virulence and HR induction
physiological function
a quantitative Super-SILAC (stable isotope labeling with amino acids in cell culture) mass spectrometry approach and analysis of proteomes of a lon mutant and a strain producing the protease are employed to determine substrate specificity and Lon-dependent physiological functions, Lon affected proteins, overview. Fundamental functions of Lon in sulfur assimilation, nucleotide biosynthesis, amino acid and central energy metabolism, besides the superoxide stress response function. Lon protease affects the MetR regulon and function of proteins MetE and MetR
physiological function
in eukaryotes, Lon 1 is localized in the mitochondria and helps maintain proper cellular function. In humans, Lon is critical for maintaining the structure and integrity of mitochondria and has been found to selectively degrade accumulating proteins damaged by oxidative stress over their native counterparts
physiological function
Lon is a highly conserved cytosolic protease belonging to the AAA+ superfamily of ATPase, and acts as a major player in general protein quality control by degrading damaged or misfolded proteins. The proteolytic activity of Lon also contributes to the post-translational regulation of functional proteins. molecular mechanisms underlying Lon-mediated virulence regulation in Erwinia amylovora, an enterobacterial pathogen of apple. Gene lon expression is under the control of CsrA, possibly at both the transcriptional and post-transcriptional levels. CsrA might positively control both T3SS and amylovoran production partly by suppressing Lon. Lon negatively regulates amylovoran by targeting RcsA, but not RcsB. Lon-dependent degradation of RcsA regulates the expression of hrpS in Erwinia amylovora. Lon is essential for motility in Erwinia amylovora
physiological function
Lon is an essential, multitasking AAA+ protease regulating many cellular processes in species across all kingdoms of life. It plays crucial role in the maintenance of mitochondrial homeostasis. Structure-based regulation of Lon enzyme function, overview
physiological function
Lon protease (Lonp1) is a nuclear encoded, mitochondrial ATP-dependent serine peptidase, which mediates the selective degradation of mutant and abnormal proteins in the organelle, and helps in the maintenance of mitochondrial homeostasis. Chaperone-like functions of Lon are involved in the assembly of mitochondrial membrane complexes in yeast and in humans, and, at least in yeast, these functions are maintained after inactivation of proteolytic site and are prevented when ATP-binding site is mutated. Together with its proteolytic and chaperone activities, Lon ability to bind DNA is conserved from bacteria to mammalian mitochondria. Lon ability to bind to DNA needs conformational changes in Lon itself, and such changes are inhibited by ATP, and are stimulated by a protein substrate
physiological function
Lon protease (Lonp1) is a nuclear encoded, mitochondrial ATP-dependent serine peptidase, which mediates the selective degradation of mutant and abnormal proteins in the organelle, and helps in the maintenance of mitochondrial homeostasis. In humans, Lon is responsible for the degradation of: 1. stably folded proteins, including 5-aminolevulinic acid synthase, steroidogenic acute regulatory protein and mitochondrial transcription factor A (TFAM) and cytochrome c oxidase 4 isoform 1 (COX4-1), 2. misfolded and unfolded proteins, including glutaminase C, and 3. oxidatively-modified proteins, including mitochondrial aconitase and cystathionine beta-synthase. Lon proteolytic activity plays a role at different stages in the mitochondrial stress response. Chaperone-like functions of Lon are involved in the assembly of mitochondrial membrane complexes in yeast and in humans, and, at least in yeast, these functions are maintained after inactivation of proteolytic site and are prevented when ATP-binding site is mutated. Together with its proteolytic and chaperone activities, Lon ability to bind DNA is conserved from bacteria to mammalian mitochondria. Unlike bacterial Lon, human Lon binds specific ssDNA. Lon ability to bind to DNA needs conformational changes in Lon itself, and such changes are inhibited by ATP, and are stimulated by a protein substrate. By selectively degrading TFAM and controlling TFAM/mtDNA ratio, Lon is responsible for mitochondrial transcription maintenance. Role of Lon protease in carcinogenesis, overview
physiological function
Lon protease (Lonp1) is a nuclear encoded, mitochondrial ATP-dependent serine peptidase, which mediates the selective degradation of mutant and abnormal proteins in the organelle, and helps in the maintenance of mitochondrial homeostasis. Together with its proteolytic and chaperone activities, Lon ability to bind DNA is conserved from bacteria to mammalian mitochondria. Lon ability to bind to DNA needs conformational changes in Lon itself, and such changes are inhibited by ATP, and are stimulated by a protein substrate
physiological function
Lon protease is one of the main participants of the proteome quality control (PQC) system supporting normal cell homeostasis. The PQC system involves molecular chaperones participating in the remodeling and disaggregation of cellular proteins and ATP-dependent peptide hydrolases, which control the level of regulatory proteins through selective proteolysis and eliminate potentially hazardous, anomalous, defective, and redundant proteins from cells through their exhaustive degradation. All proteases of the PQC system are bifunctional enzymes whose proteolytic activity is coupled with the simultaneous ATP hydrolysis and is characterized by a processive mechanism of the hydrolysis of protein targets (without the release of high-molecular-weight intermediates)
physiological function
-
Lon-DNA interactions are essential for Lon activity in cell division control. The ability of Lon to bind DNA is determined by its ATPase domain. This binding is required for processing protein substrates in nucleoprotein complexes, and Lon may help regulate DNA replication in response to growth conditions
physiological function
LonA from Escherichia coli plays a key role in the quality control system of the cell proteome. It destroys abnormal and defective polypeptides, as well as a number of regulatory proteins, according to a processive degradation mechanism
physiological function
membrane-bound ATP-dependent Lon protease is essential for cell viability and quality control of proteins, it affects membrane carotenoid content in Haloferax volanii. Enzyme LonB controls carotenoid biosynthesis in Haloferax volcanii probably by degrading enzyme/s involved in this pathway. LonB is implicated in bacterioruberin biosynthesis and protein quality control
physiological function
mitochondrial LON protease-dependent degradation of cytochrome c oxidase (CcO) subunits under hypoxia and myocardial ischemia. Lon is involved in the preferential turnover of phosphorylated CcO subunits under hypoxic/ischemic stress. Role of Lon in the degradation of phosphorylated subunits of CcO complex and importance of phosphorylation sites S40 of Vb and T52 of IVi1 subunits in Lon mediated degradation
physiological function
mitochondrial LON protease-dependent degradation of cytochrome c oxidase (CcO) subunits under hypoxia and myocardial ischemia. Lon is involved in the preferential turnover of phosphorylated CcO subunits under hypoxic/ischemic stress. Role of Lon in the degradation of phosphorylated subunits of CcO complex and importance of phosphorylation sites S40 of Vb and T52 of IVi1 subunits in Lon mediated degradation
physiological function
multidomain ATP-dependent Lon protease of Escherichia coli is one of the key enzymes of the quality control system of the cellular proteome. The HI(CC) domain of Ec-Lon protease is required for the formation of a functionally active enzyme structure and for the implementation of protein-protein interactions
physiological function
the enzyme can complement a LonB mutant in Haloferax volcanii suggesting functional conservation of LonB
physiological function
-
the Lon AAA+ protease (LonA) is an evolutionarily conserved protease that couples the ATPase cycle into motion to drive substrate translocation and degradation
physiological function
the Lon AAA+ protease (LonA) plays important roles in protein homeostasis and regulation of diverse biological processes. Proposed Mg2+- and nucleotide-dependent assembly pathway of LonA, overview
physiological function
the mitochondrial Lon protease has been identified as an integral nucleoid core factor in human mitochondria, it is involved in selective protein turnover (including ribosomal proteins)12 and the ATP-dependent degradation of misfolded or damaged mitochondrial proteins. It also has a chaperone-like function in the assembly of certain mitochondrial complexes, which persists even if its proteolytic activity is impaired. Role of Lon-mediated proteolysis in the dynamics of mitochondrial nucleic acid-protein complexes. The mitochondrial Lon protease could be involved in the regulation of such fundamental processes as nucleoid packaging, mtDNA replication, mtDNA maintenance and recombination, and the assembly of mitochondrial ribosomes
physiological function
the mitochondrial Lon protease has been identified as an integral nucleoid core factor in human mitochondria, it is involved in selective protein turnover (including ribosomal proteins)12 and the ATP-dependent degradation of misfolded or damaged mitochondrial proteins. It also has a chaperone-like function in the assembly of certain mitochondrial complexes, which persists even if its proteolytic activity is impaired. Role of Lon-mediated proteolysis in the dynamics of mitochondrial nucleic acid-protein complexes. The mitochondrial Lon protease could be involved in the regulation of such fundamental processes as nucleoid packaging, mtDNA replication, mtDNA maintenance and recombination, and the assembly of mitochondrial ribosomes
physiological function
the protein quality control network (pQC) plays critical roles in maintaining protein and cellular homeostasis, especially during stress. Protease Lon is one of the central proteases responsible for protein quality control (pQC). It is the principal enzyme that degrades most unfolded or damaged proteins. Degradation by Lon also controls cellular levels of several key regulatory proteins. Analysis of biological roles of the Lon dodecamer. The enzyme dodecamer successfully completes many of the Lon protease's important regulatory functions while modifying substrate choice, perhaps to better manage protein quality control under conditions such as UV, heat, and oxidative stress
physiological function
together with its proteolytic and chaperone activities, Lon ability to bind DNA is conserved from bacteria to mammalian mitochondria. Lon ability to bind to DNA needs conformational changes in Lon itself, and such changes are inhibited by ATP, and are stimulated by a protein substrate
physiological function
together with its proteolytic and chaperone activities, Lon ability to bind mtDNA is conserved from bacteria to mammalian mitochondria. Escherichia coli Lon binds both single stranded DNA (ssDNA) and RNA (ssRNA), and double stranded DNA (dsDNA) in a non-specific manner, and this interaction enhances Lon ATPase and proteolytic activities. Lon ability to bind to DNA needs conformational changes in Lon itself, and such changes are inhibited by ATP, and are stimulated by a protein substrate
physiological function
-
the enzyme can complement a LonB mutant in Haloferax volcanii suggesting functional conservation of LonB
-
physiological function
-
purified Lon binds double stranded as well as single stranded DNA in the presence of elevated salt concentrations
-
physiological function
-
membrane-bound ATP-dependent Lon protease is essential for cell viability and quality control of proteins, it affects membrane carotenoid content in Haloferax volanii. Enzyme LonB controls carotenoid biosynthesis in Haloferax volcanii probably by degrading enzyme/s involved in this pathway. LonB is implicated in bacterioruberin biosynthesis and protein quality control
-
physiological function
-
the alpha-domain from Lon binds to the duplex nucleotide sequence 5'-CTGTTAGCGGGC-3' from pET28a plasmid DNA sequence map and protects it from DNase I digestion. The Brevibacillus thermoruber Lon alpha-domain binds with 5'-CTGTTAGCGGGC-3' double-stranded DNA tighter than Lon alpha-domains from Escherichia coli and Bacillus subtilis, whereas the Brevibacillus thermoruber Lon alpha-domain has dramatically lower affinity for double-stranded DNA with 0 and 50% identity to the 5'-CTGTTAGCGGGC-3' binding sequence
-
physiological function
-
Lon protease is required to suppress the expression of the reb genes. Lon protease is also involved in the regulation of exopolysaccharide production and autoagglutination of bacterial cells
-
physiological function
-
the enzyme can complement a LonB mutant in Haloferax volcanii suggesting functional conservation of LonB
-
physiological function
-
ATP-dependent proteases, e.g. represented by Lon, are stress proteins that are induced in bacterial cells in response to unfavourable conditions. The enzyme negatively affects GacA protein stability and expression of the Gac/Rsm signal transduction pathway in Pseudomonas protegens, it is an important negative regulator of the Gac/Rsm signal transduction pathway in the organism. The Gac/Rsm signal transduction pathway controls secondary metabolism and suppression of fungal root pathogens via the expression of regulatory small RNAs, overview
-
physiological function
-
the enzyme can complement a LonB mutant in Haloferax volcanii suggesting functional conservation of LonB
-
physiological function
-
membrane-bound ATP-dependent Lon protease is essential for cell viability and quality control of proteins, it affects membrane carotenoid content in Haloferax volanii. Enzyme LonB controls carotenoid biosynthesis in Haloferax volcanii probably by degrading enzyme/s involved in this pathway. LonB is implicated in bacterioruberin biosynthesis and protein quality control
-
physiological function
-
lon disruption mutants show increased UV sensitivity, and produce higher levels of tabtoxin than the wild-type. Strains with lon disruption elicit the host defense system more rapidly and strongly than the wild-type strain, suggesting that the Lon protease is essential for systemic pathogenesis
-
physiological function
-
the enzyme can complement a LonB mutant in Haloferax volcanii suggesting functional conservation of LonB
-
physiological function
-
Lon protease (Lonp1) is a nuclear encoded, mitochondrial ATP-dependent serine peptidase, which mediates the selective degradation of mutant and abnormal proteins in the organelle, and helps in the maintenance of mitochondrial homeostasis. Chaperone-like functions of Lon are involved in the assembly of mitochondrial membrane complexes in yeast and in humans, and, at least in yeast, these functions are maintained after inactivation of proteolytic site and are prevented when ATP-binding site is mutated. Together with its proteolytic and chaperone activities, Lon ability to bind DNA is conserved from bacteria to mammalian mitochondria. Lon ability to bind to DNA needs conformational changes in Lon itself, and such changes are inhibited by ATP, and are stimulated by a protein substrate
-
physiological function
-
the mitochondrial Lon protease has been identified as an integral nucleoid core factor in human mitochondria, it is involved in selective protein turnover (including ribosomal proteins)12 and the ATP-dependent degradation of misfolded or damaged mitochondrial proteins. It also has a chaperone-like function in the assembly of certain mitochondrial complexes, which persists even if its proteolytic activity is impaired. Role of Lon-mediated proteolysis in the dynamics of mitochondrial nucleic acid-protein complexes. The mitochondrial Lon protease could be involved in the regulation of such fundamental processes as nucleoid packaging, mtDNA replication, mtDNA maintenance and recombination, and the assembly of mitochondrial ribosomes
-
physiological function
-
the enzyme can complement a LonB mutant in Haloferax volcanii suggesting functional conservation of LonB
-
physiological function
-
the enzyme can complement a LonB mutant in Haloferax volcanii suggesting functional conservation of LonB
-
physiological function
-
membrane-bound ATP-dependent Lon protease is essential for cell viability and quality control of proteins, it affects membrane carotenoid content in Haloferax volanii. Enzyme LonB controls carotenoid biosynthesis in Haloferax volcanii probably by degrading enzyme/s involved in this pathway. LonB is implicated in bacterioruberin biosynthesis and protein quality control
-
physiological function
-
the enzyme can complement a LonB mutant in Haloferax volcanii suggesting functional conservation of LonB
-
physiological function
-
membrane-bound ATP-dependent Lon protease is essential for cell viability and quality control of proteins, it affects membrane carotenoid content in Haloferax volanii. Enzyme LonB controls carotenoid biosynthesis in Haloferax volcanii probably by degrading enzyme/s involved in this pathway. LonB is implicated in bacterioruberin biosynthesis and protein quality control
-
physiological function
-
Lon is a highly conserved cytosolic protease belonging to the AAA+ superfamily of ATPase, and acts as a major player in general protein quality control by degrading damaged or misfolded proteins. The proteolytic activity of Lon also contributes to the post-translational regulation of functional proteins. molecular mechanisms underlying Lon-mediated virulence regulation in Erwinia amylovora, an enterobacterial pathogen of apple. Gene lon expression is under the control of CsrA, possibly at both the transcriptional and post-transcriptional levels. CsrA might positively control both T3SS and amylovoran production partly by suppressing Lon. Lon negatively regulates amylovoran by targeting RcsA, but not RcsB. Lon-dependent degradation of RcsA regulates the expression of hrpS in Erwinia amylovora. Lon is essential for motility in Erwinia amylovora
-
physiological function
-
membrane-bound ATP-dependent Lon protease is essential for cell viability and quality control of proteins, it affects membrane carotenoid content in Haloferax volanii. Enzyme LonB controls carotenoid biosynthesis in Haloferax volcanii probably by degrading enzyme/s involved in this pathway. LonB is implicated in bacterioruberin biosynthesis and protein quality control
-
physiological function
-
membrane-bound ATP-dependent Lon protease is essential for cell viability and quality control of proteins, it affects membrane carotenoid content in Haloferax volanii. Enzyme LonB controls carotenoid biosynthesis in Haloferax volcanii probably by degrading enzyme/s involved in this pathway. LonB is implicated in bacterioruberin biosynthesis and protein quality control
-
physiological function
-
membrane-bound ATP-dependent Lon protease is essential for cell viability and quality control of proteins, it affects membrane carotenoid content in Haloferax volanii. Enzyme LonB controls carotenoid biosynthesis in Haloferax volcanii probably by degrading enzyme/s involved in this pathway. LonB is implicated in bacterioruberin biosynthesis and protein quality control
-
additional information
-
eukaryotic Lon possesses three domains, an N-terminal domain, an ATPase domain and a proteolytic domain
additional information
-
the AAA+ ATPase module and protease domain of Lon are part of a single polypeptide
additional information
the N-terminal substrate-recognition domain of a LonC protease exhibits structural and functional similarity to cytosolic chaperones
additional information
-
the N-terminal substrate-recognition domain of a LonC protease exhibits structural and functional similarity to cytosolic chaperones
additional information
-
the second alpha-helical domain plays a crucial role in ATP hydrolysis and enzyme binding to the target protein, while the first alpha-helical domain is not important for the manifestation of the catalytic properties of the enzyme, but it affects the functioning of Lon ATPase and peptidase sites and is involved in maintaining enzyme stability, participation of the first alpha-helical domain in the formation of three-dimensional structures of LonA proteases and/or their complexes with DNA
additional information
-
crystal structure determination of AAA+ module. Structural basis for the ATP-independent proteolytic activity of LonB proteases and reclassification of their AAA+ modules, overview. The isolated AAA+ module, having no bound nucleotide, adopts a conformation virtually identical to the ADP-bound conformation of AAA+ modules in the hexameric structure of TonLonB. Despite the conservation of functional motifs, the iAAA+ module has no ATPase activity. In the hexameric conformation, an arginine finger (Arg311) in one AAA+ module stabilizes negative charge of gamma-phosphate of ATP bound to the adjacent AAA+ module, which is essential for ATP hydrolysis
additional information
hLon's N-terminal domains are crucial for the overall structure of the hLon, maintaining a conformation allowing its proper functioning. Model on the quaternary structure of the full-length enzyme protein
additional information
-
hLon's N-terminal domains are crucial for the overall structure of the hLon, maintaining a conformation allowing its proper functioning. Model on the quaternary structure of the full-length enzyme protein
additional information
-
homology modeling of the Xanthomonas citri subsp. citri Lon P domain by using the Escherichia coli Lon structure as a template. Structural simulation using a phosphomimetic aspartic acid at position 654 of the P domain reveals the formation of two new H bonds between two structurally adjacent residues, A655 and S658 after phosphorylation of Ser654
additional information
Mg2+-activated LonA can operate as a diffusion-based chambered protease to degrade unstructured protein and peptide substrates efficiently in the absence of ATP. Mg2+-dependent remodeling of a substrate-binding loop and a potential metal-binding site near the Ser-Lys catalytic dyad, supported by biophysical binding assays and molecular dynamics simulations, domain arrangement and structural modeling, overview
additional information
the C-terminal part of the HI(CC) domain has an allosteric effect on the efficiency of the functioning of both ATPase and proteolytic sites of the enzyme, while the coiled-coil (CC) fragment of this domain interacts with the protein substrate. Analysis of the propensity of C-His-Lon and mutant enzymes Lon-R164A, Lon-R192A, and Lon-Y294A for utodegradation reveals that Lon-Y294A is most prone to autolysis. Slight autolysis of the intact enzyme and the mutant forms of Lon-R164A and Lon-R192A is observed only in the absence of nucleotides
additional information
-
the C-terminal part of the HI(CC) domain has an allosteric effect on the efficiency of the functioning of both ATPase and proteolytic sites of the enzyme, while the coiled-coil (CC) fragment of this domain interacts with the protein substrate. Analysis of the propensity of C-His-Lon and mutant enzymes Lon-R164A, Lon-R192A, and Lon-Y294A for utodegradation reveals that Lon-Y294A is most prone to autolysis. Slight autolysis of the intact enzyme and the mutant forms of Lon-R164A and Lon-R192A is observed only in the absence of nucleotides
additional information
the catalytic dyad required for peptide-bond hydrolysis is localized at Ser885-Lys896
additional information
the CC region is involved in the recognition of the nucleotide nature by the enzyme and the interaction of the enzyme with the protein substrate, effect of the coiled-coil (CC) region of the alpha-helical inserted domain of Escherichia coli Lon protease (Ec-Lon) on the functional activity of the enzyme, overview. The CC region is necessary for the formation and functioning of the ATPase and peptidase active centers, the occurrence of allosteric interactions between them, and for the implementation of proteolysis by a unique processive mechanism
additional information
the enzyme Ec-Lon is a bifunctional homohexameric enzyme, its subunit comprises an N-terminal noncatalytic region, two-domain ATPase module, and a proteolytic domain with serine-lysine endopeptidase activity
additional information
the enzyme has a Ser-Lys catalytic dyad
additional information
the enzyme's active site has a Ser-Lys catalytic dyad
additional information
-
the translational and rotational movements in the AAA+ module induced by the nucleotide have a profound impact on the Arg finger Arg484 location and P-loop conformation in ATPase sites. In the nucleotide-free state, the P loop is in an open conformation. In contrast, in the ADP-bound state, the P loop is well formed to accommodate the bound nucleotide
additional information
while proteolytic activity is restricted at the P domain, chaperone activity ismediated by the ATP-binding domain and the N-terminal domain. The chaperone and degradation chambers are contiguous and there is virtually no constriction of the chamber between the chaperone domain and the protease active sites
additional information
-
the enzyme has a Ser-Lys catalytic dyad
-
additional information
-
the enzyme has a Ser-Lys catalytic dyad
-
additional information
-
the enzyme has a Ser-Lys catalytic dyad
-
additional information
-
the enzyme has a Ser-Lys catalytic dyad
-
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
hexamer or heptamer
-
stabilized by Mg2+ and ADP bound to the ATPase region
homooligomer
-
the subunits are formed by five successively connected domains, i.e., N-terminal domain, alpha-helical domain, nucleotide-binding domain, second alpha-helical domain, and proteolytic domain, domain organization, overview
?
x * 90700, calculated and SDS-PAGE
?
-
x * 90000, SDS-PAGE
-
?
x * 83000, recombinant enzyme, SDS-PAGE
?
x * 77000, recombinant His-tagged Lon-like-Ms, SDS-PAGE
?
-
x * 77000, recombinant His-tagged Lon-like-Ms, SDS-PAGE
-
?
-
x * 84269, calculated
-
?
x * 89000, Lon, SDS-PAGE
?
-
x * 88800, calculated
-
dodecamer
-
hexamers of Escherichia coli Lon also interact to form a dodecamer at physiological protein concentrations, the dodecamer shows a prolate structure with the protease chambers at the distal ends and a matrix of N domains forming an equatorial hexamer-hexamer interface, with portals of about 45 A providing access to the enzyme lumen
dodecamer
the larger assembly has decreased ATPase activity and displays substrate-specific alterations in degradation compared to the hexamer. The enzyme dodecamer successfully completes many of the Lon protease's important regulatory functions while modifying substrate choice, perhaps to better manage protein quality control under conditions such as UV, heat, and oxidative stress. Identification of N domain interactions underlying Lon dodecamer formation. The Lon N domains are primarily responsible for dodecamer formation, the Lon dodecamer forms via putative N domain coiled-coil interactions. Analytical ultracentrifugation
heptamer
-
cryoelectron microscopy
heptamer
-
7 * 117000, SDS-PAGE
heptamer
-
cryoelectron microscopy
heptamer
-
cryoelectron microscopy and analytic ultracentrifugation
heptamer
-
electron microscopic image analysis
heptamer
-
ring-shaped protease with seven flexible subunits, ultracentrifugation thus showed lon to be a heptamer, in excellent agreement with the STEM analysis
heptamer
-
maize Lon can form a heptameric ring similar to that of yeast Lon. Enzyme with considerably less stability than other mitochondrial Lon proteases. Properties compared with ATP-dependent proteases from different sources
hexamer
-
crystallography
hexamer
6 * 90000, SDS-PAGE, 6 * 88000, calculated
hexamer
-
gel filtration, sedimentation velocity experiments and cross-linking of intact and truncated species
hexamer
-
6 * 90000, SDS-PAGE, 6 * 88000, calculated
-
hexamer
-
6 * 106000, human, calculated from amino acid sequence
hexamer
-
crystallography
hexamer
-
electron microscopy
hexamer
-
negative stain electron microscopy, crystallography of the proteolytic domain
hexamer
gel filtration and glutaraldehyde crosslinking
hexamer
active enzyme form, modeling of the structure of the human mitochondrial Lon hexamer, overview
hexamer
hLon has a unique three-dimensional structure, in which the proteolytic and ATP-binding domains (AP-domain) form a hexameric chamber, while the N-terminal domain is arranged as a trimer of dimers. These two domains are linked by a narrow trimeric channel composed likely of coiled-coil helices. In the presence of AMP-PNP, the AP-domain has a closedring conformation and its N-terminal entry gate appears closed, but in ADP binding, it switches to a lock-washer conformation and its N-terminal gate opens, which is accompanied by a rearrangement of the N-terminal domain. hLon's N-terminal domains are crucial for the overall structure of the hLon, maintaining a conformation allowing its proper functioning. Domain structure, overview
hexamer
Mg2+-activated LonA forms an open hexameric chamber without nucleotide
hexamer
-
analytical ultracentrifugation
hexamer
-
6 * 105000, SDS-PAGE
hexamer
-
6 * 120000, Saccharomyces cerevisiae, SDS-PAGE
hexamer
-
6 * 106000, human, calculated from amino acid sequence
hexamer
-
6 * 105000, SDS-PAGE
hexamer
-
6 * 120000, Saccharomyces cerevisiae, SDS-PAGE
hexamer
-
6 * 120000, SDS-PAGE
hexamer
6 * 65856, calculated
hexamer
6 * 72000, calculated
hexamer
-
6 * 72000, SDS-PAGE
homohexamer
-
-
homohexamer
Lon assembles into a barrel-shaped homohexamer with the proteolytic active sites sequestered in an internal chamber, largely inaccessible to folded proteins. This architecture serves to prevent degradation of non-substrate proteins. Analysis of hexamer-hexamer interactions, usage of an ellipsoidal electron density map sufficient to model two barrel-shaped hexamers at the distal ends of the dodecamer corresponding to the Lon ATPase and protease modules. The two barrels are bridged by six extended helical structures, which are modeled as six N domain dimers forming end-to-end interactions that mimic two-stranded, antiparallel coiled coils
monomer
-
proteolytic domain in solution
monomer
1 * 87400, calculated. Mixture of monomeric and larger oligomeric species, with increasing amounts of larger oligomers present at larger concentrations
monomer
-
proteolytic domain in solution
multimer
-
SDS-PAGE
multimer
-
x * 87000, calculated from DNA sequence
multimer
-
x * 88000, calculated from nucleotide sequence
multimer
-
x * 94000, SDS-PAGE
oligomer
x * 68200, the subunit consist of ATPase and proteolytic domains
oligomer
x * 87400, calculated. Mixture of monomeric and larger oligomeric species, with increasing amounts of larger oligomers present at larger concentrations
oligomer
-
6-7 * 100000, homo-oligomeric complex, SDS-PAGE
tetramer
-
4 * 87000,
tetramer
-
4 * 87000, homotetramer
additional information
-
the enzyme has two domains: the N-terminal ATPase domain with chaperone-like properties and the C-terminal proteolytic domain specific for the ATP-dependent protease family
additional information
protein consists of an N-terminal domain, a central ATPase domain which includes a sensor- and substrate-discrimination domain, and a C-terminal protease domain
additional information
-
protein consists of an N-terminal domain, a central ATPase domain which includes a sensor- and substrate-discrimination domain, and a C-terminal protease domain
-
additional information
-
electron-microscope analysis, enzyme has a six-membered, ring-shaped structure with a central cavity. Side-on view shows a two-layered structure
additional information
-
isolated proteolytic domain LonP, obtained by limited proteolysis, exhibits both peptidase and proteolytic activity, but cleaves large protein substrates at a significantly lower rate than the full size protease. LonAP fragment, containing both the ATPase and the proteolytic domains, retains almost all of the enzymawtic properties of the full-size protein. both LonP and LonAP predominantly form dimers unlike the native protease Lon functioning as a tetramer
additional information
-
the ATPase fragment isolated after chymotryptic digestion of the protein has no ATPase activity in spite of its ability to bind nucleotides. It is monomeric in solution. The isolated monomeric proteolytic fragment does not display proteolytic activity. The intact ATPase/proteolytic fragment forms dimers and tetramers and exhibits properties of a non-processive protease and show ATPase activity with self-degradation upon ATP hydrolysis
additional information
-
compared with hexamers, enzyme dodecamers are much less active in degrading large substrates but equally active in degrading small substrates
additional information
domain organization of Lon protease, overview
additional information
each Lon monomer contains three functional subregions: the N domain, AAA+ ATPase module, and a protease domain. The ATPase and protease domains are the most well-conserved regions of Lon
additional information
-
each Lon monomer contains three functional subregions: the N domain, AAA+ ATPase module, and a protease domain. The ATPase and protease domains are the most well-conserved regions of Lon
additional information
enzyme Ec-Lon subunit includes an ATPase component and a proteolytic component (AAA+ module and P-domain, respectively), as well as a noncatalytic region formed by the N-terminal (N) domain and an inserted alpha-helical (HI(CC)) domain. This region is unique for AAA+ proteins. The C-terminal part of the HI(CC) domain has an allosteric effect on the efficiency of the functioning of both ATPase and proteolytic sites of the enzyme, while the coiled-coil (CC) fragment of this domain interacts with the protein substrate. The HI(CC) domain is not essential for the formation of the ATPase center of Ec-Lon protease, but still has an effect on the functional efficiency of this center. Detailed analysis and comparisons of primary and secondary structures of the HI(CC) domain in AAA* proteases, overview
additional information
-
enzyme Ec-Lon subunit includes an ATPase component and a proteolytic component (AAA+ module and P-domain, respectively), as well as a noncatalytic region formed by the N-terminal (N) domain and an inserted alpha-helical (HI(CC)) domain. This region is unique for AAA+ proteins. The C-terminal part of the HI(CC) domain has an allosteric effect on the efficiency of the functioning of both ATPase and proteolytic sites of the enzyme, while the coiled-coil (CC) fragment of this domain interacts with the protein substrate. The HI(CC) domain is not essential for the formation of the ATPase center of Ec-Lon protease, but still has an effect on the functional efficiency of this center. Detailed analysis and comparisons of primary and secondary structures of the HI(CC) domain in AAA* proteases, overview
additional information
the Ec-Lon subunit comprises N-terminal non-catalytic region, ATPase module and proteolytic domain (serine-lysine endopeptidase)
additional information
the inserted alpha-helical HI(CC) domain is necessary for the formation of the ATPase center of the Ec-Lon protease and its correct functioning
additional information
-
the inserted alpha-helical HI(CC) domain is necessary for the formation of the ATPase center of the Ec-Lon protease and its correct functioning
additional information
-
enzyme binds GT-rich sequences found in the heavy strand of mitochondrial DNA and also interacts specifically with GU-rich RNA. Nucleotide inhibition and protein substrate stimulation coordinately regulate DNA binding
additional information
-
Lon protease specifically binds single stranded DNAs with a propensity for forming parallel G-quartets. Lon binding to the 24-base oligomer LSPas, AATAATGTGTTAGTTGGGGGGTGA is primarily driven by enthalpy change associated with a significant reduction in heat capacity. The Lon-LSPas complex shows a considerable enhancement in thermal stability. Lon binding to an 8-base G-rich core sequence, TG6T is entropically driven with a relatively negligible change in heat capacity
additional information
-
eukaryotic Lon possesses three domains, an N-terminal domain, an ATPase domain and a proteolytic domain
additional information
model on the quaternary structure of the full-length enzyme protein
additional information
-
model on the quaternary structure of the full-length enzyme protein
additional information
quaternary enzyme structure, modelling, overview
additional information
-
quaternary enzyme structure, modelling, overview
additional information
Mg2+-dependent activation and hexamerization of the Lon AAA+ protease. Role of the protease domains in the oligomerization and activity of LonA, overview
additional information
-
the lon protease of Pyrococcus abyssi is interupted by an intein. The intein splices essentially to completion when over-expressed in Escherichia coli. Blocking the first step of splicing with a Cys1 to Ala mutation or step two of splicing with a Ser+1 to Ala mutation leads to the accumulation of precursor. Substitution of Ser+1 with Thr results in precursor, whereas substitution to Cys results in efficient splicing. Prevention of step three of splicing by mutation of the intein C-terminal Asn333 to Ala results in the accumulation of precursor and branched-ester intermediate
additional information
while proteolytic activity is restricted at the P domain, chaperone activity is mediated by the ATP-binding domain and the N-terminal domain
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
D508A
reduction of enzymic activity
deltaTM(1)-lon-S509A
possesses neither proteolytic nor ATPase activity, is completely stable, can be considered as model of initial active delta TM(1)-lon forms
deltaTM(2)-lon-S509A
possesses neither proteolytic nor ATPase activity, is completely stable, can be considered as model of initial active delta TM(2)-lon forms
deltaTM1-lon
deletion of 100-186, leads to the removal of the predicted hydrophobic site of the transmembrane domain
deltaTM2-lon
deletion of 119-222, leads to the removal of the predicted hydrophobic site of the transmembrane domain
E506A
reduction of enzymic activity
S509A
loss of enzymic activity
T534A
-
retains significant proteolytic activity
S714A
mutation of the predicted catalytic site serine residue. Mutant does not show catalytic activity. In presence of ATP, mutant exhibits a chaperone-like activity by inhibiting the aggregation of insulin beta-chain
D743N
-
site-directed mutagenesis
E240K
-
site-directed mutagenesis
E424Q
-
site-directed mutagenesis, the mutant is unable to inactivate SulA in vivo and displays reduced rates of both basal and substrate-stimulated ATP hydrolysis. The mutant translocates and degrades CM-titinI27-sul20 and CM-titinI27-beta20 at a very slow rate. The mutation stabilizes the enzyme conformation that is active in relieving stress
E424Q/S679A
-
site-directed mutagenesis, the mutant is unable to inactivate SulA in vivo and displays reduced rates of both basal and substrate-stimulated ATP hydrolysis
H665Y
-
site-directed mutagenesis
H667Y
-
site-directed mutagenesis
K362A
-
site-directed mutagenesis
K362Q
-
intersubunit domain-domain interactions between ATPase and proteolytic sites by complementation
K371E/K376E/R379E
-
site-directed mutagenesis, mutant demonstrates significantly reduced DNA binding capabilities compared to wild-type enzyme. The Lon mutant does not restore cell length in the lon-/- strain, cells remained filamentous
Q220C
site-directed mutagenesis, the mutant reproducibly yields fast and robust intermolecular disulfide crosslinking. The cysteine-based disulfide crosslinking is responsible for the formation of the SDS-resistant dimers
R192A
site-directed mutagenesis, mutation of a HI(CC) domain residue, the mutant shows highly reduced ATPase activity in presence of beta-casein compared to the wild-type
R306E/K308E/K310E/K311E
-
site-directed mutagenesis, the mutant demonstrates significantly reduced DNA binding capabilities compared to wild-type enzyme. The Lon mutant does not restore cell length in the lon-/- strain, cells remained filamentous
R542A
-
site-directed mutagenesis, the mutant completely loses its ability to hydrolyze ATP, the mutant retains the ability to hydrolyze PepTBE in the absence of effectors
T704A
-
retains significant proteolytic activity
V217A/Q220A
site-directed mutagenesis, residues Val217 and Gln220 are present in a region predicted to form intermolecular coiled coils between hexamers, the Lon mutant variant (LonVQ) forms a dodecamer with increased stability compared to wild-type. The dodecamer is active, but it exhibits alterations in substrate selection and/or degradation. Mutant LonVQ is altered in recognition of dodecamer-sensitive substrates in vivo
V217C
site-directed mutagenesis, the mutant reproducibly yields fast and robust intermolecular disulfide crosslinking. The cysteine-based disulfide crosslinking is responsible for the formation of the SDS-resistant dimers
Y294A
site-directed mutagenesis, mutation of a HI(CC) domain residue, the mutant shows highly reduced ATPase activity in presence of beta-casein compared to the wild-type
Y398A
-
site-directed mutagenesis, the mutant has basal ATP-hydrolysis activity similar to wild-type Lon, but displays substantially reduced rates of ATP hydrolysis in the presence of sul20- or beta20-tagged substrates
E614K
-
single point mutation in the gene lonR9
-
delta75-490
-
dominant negative mutant, exhibits a remarkable decrease in acyl-CoA oxidase and mislocalization of catalase to the cytoplasm. Shows lower beta-oxidation activity than wild-type
G893A
-
site-directed mutagenesis, the mutant shows 63% of wild-type ATPase activity, 80% of wild-type protease activity, and 2.27fold of the activation by beta-casein compared to the wild-type enzyme
G893A/G894A
-
site-directed mutagenesis, the mutant shows 103% of wild-type ATPase activity, 79% of wild-type protease activity, and 0.745fold of the activation by beta-casein compared to the wild-type enzyme
G893A/G894P
-
site-directed mutagenesis, the mutant shows 112% of wild-type ATPase activity, no protease activity, and 0.32fold of the activation by beta-casein compared to the wild-type enzyme
G893P
-
site-directed mutagenesis, the mutant shows 89% of wild-type ATPase activity, no protease activity, and 0.49fold of the activation by beta-casein compared to the wild-type enzyme
G893P/G894A
-
site-directed mutagenesis, the mutant shows 71% of wild-type ATPase activity, 8% of wild-type protease activity, and 0.23fold of the activation by beta-casein compared to the wild-type enzyme
G894A
-
site-directed mutagenesis, the mutant shows 139% of wild-type ATPase activity, 76% of wild-type protease activity, and 0.49fold of the activation by beta-casein compared to the wild-type enzyme
G894P
-
site-directed mutagenesis, the mutant shows 130% of wild-type ATPase activity, 84% of wild-type protease activity, and 0.23fold of the activation by beta-casein compared to the wild-type enzyme
G894S
-
site-directed mutagenesis, the mutant shows 140% of wild-type ATPase activity, 47% of wild-type protease activity, and 0.88fold of the activation by beta-casein compared to the wild-type enzyme
K529R
-
site-directed mutagenesis, inactive mutant
S743A
-
point mutant at the center of the protease catalytic domain
S885A
-
site-directed mutagenesis, three-dimensional structure of the ADP-bound Lon S885A mutant obtained by electron microscopy as a result of preliminary negative staining studies
T880V
-
site-directed mutagenesis, the mutant shows 46% of wild-type ATPase activity, 107% of wild-type protease activity, and 3.28fold of the activation by beta-casein compared to the wild-type enzyme
W770A
-
site-directed mutagenesis, the mutant shows 98.5% of wild-type ATPase activity, 6.4% of wild-type protease activity, and 0.305fold of the activation by beta-casein compared to the wild-type enzyme
W770P
-
site-directed mutagenesis, the mutant shows 123% of wild-type ATPase activity, 55.3% of wild-type protease activity, and 0.64fold of the activation by beta-casein compared to the wild-type enzyme
H697Q
-
site-directed mutagenesis
S652C
-
site-directed mutagenesis
S690A
-
site-directed mutagenesis
I359M
-
site-directed mutagenesis
I398G
site-directed mutagenesis
L91M
-
site-directed mutagenesis
L91M/I359M
-
site-directed mutagenesis, structure analysis with bound inhibitors
L91M/L188M/I359M
site-directed mutagenesis, the three mutations are introduced into the wild-type sequence to facilitate de novo phasing
R536/R584
-
paddle-like movement of R536/R584 induced by the ATPase cycle at the groove may play an important role in substrate degradation
R563A
-
site-directed mutagenesis
R584A
-
site-directed mutagenesis
S678A
site-directed mutagenesis
Y397G
site-directed mutagenesis
Y397G/I398G
site-directed mutagenesis, the mutant fails to degrade alpha-casein with Mg2+ and ATP. The Mg2+-activated double mutant showed wild-type-like ATP-independent proteolysis
S675A
-
constructed mutation of the active site region
S675C
-
constructed mutation of the active site region
S675T
-
constructed mutation of the active site region
D93A
-
mutations result in efficient splicing
H94A
-
mutation results in the accumulation of precursor
K332A
-
mutation results mostly in splicing, with some accumulation of branched-ester intermediate
K332H
-
mutation results mostly in splicing, with some accumulation of branched-ester intermediate
K332R
-
mutation results in splicing as efficient as wild-type
N333A
-
prevention of step three of the intein splicing, mutation results in the accumulation of precursor and branched-ester intermediate
P92A
-
mutations results in efficient splicing
T91A
-
mutation results in the accumulation of precursor
S680A
-
displays both intrinsic and peptide-stimulated ATP hydrolysis activity comparable to that of the wild-type enzyme but is unable to catalyze peptide bond hydrolysis. Active site serine is required for interaction of inhibitor with lon
V378I
-
naturally occurring conservative mutation
D241A
-
99% of wild-type peptidase activity
K568A
loss of peptidase activity, retention of ATPase activity and oligomerization to hexamer
K63A
-
113% of wild-type peptidase activity
N293A
-
122% of wild-type peptidase activity
R305A
-
2% of wild-type peptidase activity
R375A
-
112% of wild-type peptidase activity
R382A
-
6% of wild-type peptidase activity
S525A
loss of peptidase activity, retention of ATPase activity and oligomerization to hexamer
S654A
-
site-directed mutagenesis, LonS654A is no longer able to be phosphorylated and the mutant loses its virulence. Pathogenicity can fully be restored by addition of exogenous wild-type N-terminally His-tagged HrpG, although not by C-terminally His-tagged HrpG
S654D
-
site-directed mutagenesis, the mutant partially retaines its pathogenicity
S654E
-
site-directed mutagenesis, the mutant retaines its pathogenicity
S684A
site-directed mutagenesis, catalytic site mutant
S684A
-
site-directed mutagenesis, catalytic site mutant
-
D676N
-
site-directed mutagenesis
D676N
-
is completely inactive for protein degradation, it retains some basal ATPase activity, but no activation of ATPase activity occurs upon binding of protein substrates
E614K
-
single point mutation in the gene lonR9
E614K
-
is a dominant-negative mutant, can form mixed oligomers with wild-type lon and interferes with its activity
E614K
-
mixed oligomeric complexes composed of wild-type lon and the inactive lon E614K mutant, results in an enzymatically inactive protein
R164A
-
site-directed mutagenesis, the ATPase activity of the mutant is markedly reduced compared to the wild-type enzyme, thhe mutant retains the ability to hydrolyze PepTBE in the absence of effectors
R164A
site-directed mutagenesis, mutation of a HI(CC) domain residue, helix H3, the mutant shows highly reduced ATPase activity in presence of beta-casein compared to the wild-type
S679A
-
site-directed mutagenesis
S679A
-
proteolytically inactive
S679A
-
inactive, intersubunit domain-domain interactions between ATPase and proteolytic sites by complementation
S679A
-
proteolytically inactive, but wild-type-like intrinsic and peptide-stimulated ATPase activitiy. Two-step peptide S4 binding event, where a conformational change occurs after a rapid equilibrium peptide binding step
S679A
-
complete loss of activity. Mutant is not capable of restoring the secB cold sensitive phenotype, indicating that the deleterious effect of Lon in the secB mutant is due to its protease activity
S679A
-
site-directed mutagenesis, the S679A mutation destabilizes the enzyme conformation that is active in relieving stress
S679A
interaction analysis with thrombin-derived aptamers, overview
S679A
site-directed mutagenesis, the Lon trapping variant is able to translocate substrates but unable to degrade them, it is established and used for substrate determinations by mass spectrometry
S679W
-
proteolytically inactive mutant. ATPase activity is affected by a variety of mutations generated at the vicinity of the proteolytic site Ser 679. Mutation of the ATP-binding site abolishes both the ATPase and protease activities of lon
S679W
-
proteolytically inactive, but wild-type-like intrinsic and peptide-stimulated ATPase activitiy. Two-step peptide S4 binding event, where a conformational change occurs after a rapid equilibrium peptide binding step
S855A
-
site-directed mutagenesis
S855A
-
site-directed mutagenesis, the mutant shows 78% of wild-type ATPase activity, no protease activity, and 0.35fold of the activation by beta-casein compared to the wild-type enzyme
S855A
site-directed mutagenesis, a proteolytically inactive hLon mutant which retains near wild-type levels of ATPase activity
S855A
the Lon mutant, which lacks both ATPase and proteolytic activity, still maintains DNA binding activity but, in this case, does not undergo conformational changes
E423Q
site-directed mutagenesis, structure determination
E423Q
-
site-directed mutagenesis, mutation of the conserved catalytic glutamate 423 in Walker B motif treatment of Core-E423Q with Mg2+ induces the formation of the open-chambered hexamer. In the crystal, each asymmetric unit contains one hexameric assembly, with three non-neighboring protomers (B/D/F) bound to ADP and the other three (A/C/E) nucleotide free. The bound nucleotide is identified as ADP, which may have resulted from spontaneous hydrolysis of ATP. Each Core-E423Q protomer forms an alpha/beta domain capped with a distinct N-terminal three-helix bundle, a middle a domain, and a C-terminal PD, which are together organized into an elongated structure. Six LonA protomers are packed against one another like an orange's carpels and assembled into a cupcake-shaped complex
K638N
-
site-directed mutagenesis
K638N
-
constructed Lon mutant
S1015A
-
site-directed mutagenesis
S1015A
-
constructed Lon mutant
additional information
-
enzyme null mutant, very slow growth of strain, being not filamentous and exhibiting normal resistance to UV irradiation. Mutant displays severe defects in morphology, 80% of cells appear Y-shaped. Mutant is highly attenuated for virulence
additional information
-
deletion of the transmembrane domain results in uncontrollable activation of the enzyme proteolytic site and in vivo autolysis yielding a stable and functionally inactive fragment consisting of both alpha-helical and proteolytic domains
additional information
deletion of the transmembrane domain results in uncontrollable activation of the enzyme proteolytic site and in vivo autolysis yielding a stable and functionally inactive fragment consisting of both alpha-helical and proteolytic domains
additional information
-
deletion of the transmembrane domain of LonB protease results in uncontrollable activation of the enzyme proteolytic site and in vivo autolysis yielding a stable and functionally inactive fragment consisting of both alpha-helical and proteolytic domains. The enzyme form with a transmembrane deletion and an additional site-directed mutagenesis at S509A (the catalytic Ser residue), is capable of recombination with the proteolytic-domain fragment. The mixed oligomers are proteolytically active, which indicates a crucial role of subunit interactions in the activation of the proteolytic site
additional information
deletion of the transmembrane domain of LonB protease results in uncontrollable activation of the enzyme proteolytic site and in vivo autolysis yielding a stable and functionally inactive fragment consisting of both alpha-helical and proteolytic domains. The enzyme form with a transmembrane deletion and an additional site-directed mutagenesis at S509A (the catalytic Ser residue), is capable of recombination with the proteolytic-domain fragment. The mixed oligomers are proteolytically active, which indicates a crucial role of subunit interactions in the activation of the proteolytic site
additional information
knockout mutant generation by lon gene deletion, generation of a lon/reb double knockout mutant
additional information
-
knockout mutant generation by lon gene deletion, generation of a lon/reb double knockout mutant
additional information
-
knockout mutant generation by lon gene deletion, generation of a lon/reb double knockout mutant
-
additional information
-
lonB disruption does not affect sporulation
additional information
Lon-2 is able to functionally complement an Escherichia coli Lon mutant
additional information
Lon-2 is able to functionally complement an Escherichia coli Lon mutant
additional information
-
Lon-2 is able to functionally complement an Escherichia coli Lon mutant
additional information
design of truncated enzyme mutants. N-terminal domain is essential for oligomerization. Truncation of N-terminal domain also leads to inactivation of proteolytic, ATPase, and chaperone-like activities of enzyme but retains the DNA-binding activity
additional information
-
design of truncated enzyme mutants. N-terminal domain is essential for oligomerization. Truncation of N-terminal domain also leads to inactivation of proteolytic, ATPase, and chaperone-like activities of enzyme but retains the DNA-binding activity
additional information
-
construction of randomly chosen N-terminally truncated mutants. Mutants lacking amino acids from 1 to 247 of N-terminus retain significant peptidase and ATPase activities, but lose 90% of protease activity. Further truncation of the protein results in the loss of all three activities. Mutants lacking amino acids 246-259 or 248-256 also lose all activities and quaternary structure
additional information
-
construction of randomly chosen N-terminally truncated mutants. Mutants lacking amino acids from 1 to 247 of N-terminus retain significant peptidase and ATPase activities, but lose 90% of protease activity. Further truncation of the protein results in the loss of all three activities. Mutants lacking amino acids 246-259 or 248-256 also lose all activities and quaternary structure
-
additional information
-
design of truncated enzyme mutants. N-terminal domain is essential for oligomerization. Truncation of N-terminal domain also leads to inactivation of proteolytic, ATPase, and chaperone-like activities of enzyme but retains the DNA-binding activity
-
additional information
-
mutant in the lon gene, growth is impaired at high temperature. Mutants show reduced motility, less autoagglutination, and lower levels of invasion of INT407 epithelial cells. Inactivation of lon has a minor effect on the proteome
additional information
-
mutant in the lon gene, growth is impaired at high temperature. Mutants show reduced motility, less autoagglutination, and lower levels of invasion of INT407 epithelial cells. Inactivation of lon has a minor effect on the proteome
-
additional information
-
lon mutants, show defects in cell division, are unable to control initiation of DNA replication
additional information
generation of an insertional mutant strain with a defect in the lon gene in the background of the wild-type strain Ea1189. The Ea1189 lon mutant exhibits a mucoid colony on growth medium and produces about 10 times more amylovoran than that of the wild-type strain, which can be partially complemented. The Ea1189 lon mutant induces a typical hypersensitive response lesion on tobacco and is as pathogenic as wild-type on immature pears, although the disease progress is similar or slightly faster in the mutant at 4 days post-inoculation
additional information
-
generation of an insertional mutant strain with a defect in the lon gene in the background of the wild-type strain Ea1189. The Ea1189 lon mutant exhibits a mucoid colony on growth medium and produces about 10 times more amylovoran than that of the wild-type strain, which can be partially complemented. The Ea1189 lon mutant induces a typical hypersensitive response lesion on tobacco and is as pathogenic as wild-type on immature pears, although the disease progress is similar or slightly faster in the mutant at 4 days post-inoculation
additional information
-
generation of an insertional mutant strain with a defect in the lon gene in the background of the wild-type strain Ea1189. The Ea1189 lon mutant exhibits a mucoid colony on growth medium and produces about 10 times more amylovoran than that of the wild-type strain, which can be partially complemented. The Ea1189 lon mutant induces a typical hypersensitive response lesion on tobacco and is as pathogenic as wild-type on immature pears, although the disease progress is similar or slightly faster in the mutant at 4 days post-inoculation
-
additional information
-
overproduction of enzyme is lethal. Overproduction specifically inhibits translation through specific activation of YoeB-dependent mRNA cleavage
additional information
-
in an endogenous protein tagging assay, lon mutants accumulate excessive levels of tmRNA-tagged proteins. In a reporter protein tagging assay with lambda-CI-N, lon mutants efficiently tag the reporter protein, but the tagged protein exhibits increased stability. GFP construct containing a hard-coded C-terminal tmRNA tag exhibits increased stability in lon mutant cells
additional information
-
lon clp ppk triple mutant, rate of protein turnover ist nearly identical to that of the lon clp double mutant. Deletion mutants of lon fused to the C-terminus of maltose-binding protein
additional information
-
lon gene mutants, form long undivided filaments upon UV irradiation
additional information
-
lon mutant altered in substrate specificity. A mutation in lon that converts Glu240 to Lys results in stabilization of lon substrate RcsA in vivo but does not affect the degradation of lon substrate SulA. lon lacking 107 N-terminal residues has drastically reduced protein degrading activity in vitro
additional information
-
lon mutant, confers partial resistance against colicin. Sensitivity of lon mutant to colicin can be rescued by complementation. Decrease in the protein expression levels of BtuB and OmpF in the lon mutant, which are involved in colicin translocation. Elevation of expression of the oxyS gene, which can negatively control on the expression of BtuB protein
additional information
-
lon mutants, accumulate abnormal proteins, form mucoid colonies and long filaments, fail to adapt rapidly to a nutrional downshift, are sensitive to UV at 30°C because of SulA accumulation, at higher temperatures they lose their sensitivity because ClpYQ takes over SulA degredation
additional information
-
lon- mutants survive equally well under aerobic conditions as the wild-type, but die more rapidly than the wild-type under anaerobiosis. Effect is not mediated through a compensatory increase in the Clp protease
additional information
-
in gene disruption mutant lon::Tn10 members of the RcsA regulon and many genes of the sigmaS-dependent general stress response are upregulated. The lon mutation does not affect sigmaS levels nor sigmaS activity in general. Lon-affected genes also include the major acid resistance genes
additional information
-
the combined absence of Lon and SecB leads to a significant increase in protein aggregation at 37°C. The most abundant aggregated species are proteins destined for export. Data suggest that Lon and SecB share some substrates and that the SecB chaperone protects them from Lon degradation at both high and low temperatures
additional information
-
construction of enzyme mutants, fusion of the Lon N domain to Escherichia coli ClpXDELTAN, a AAA+ enzyme that forms stable ring hexamers. Chimera307 contained the entire Lon N domain (residues 1-307) fused to ClpXDELTAN, whereas chimera211 contains the first 211 residues of Lon, which includes a globular region of the N domain but not an extended helical region. In addition, chimera211 contains disulfide bonds between the subunits of ClpXDELTAN, which have been shown to stabilize functional covalent hexamers. The ClpXDELTAN hexamerization is required for functional interaction with ClpP
additional information
analysis of the propensity of C-His-Lon and mutant enzymes Lon-R164A, Lon-R192A, and Lon-Y294A for autodegradation reveals that Lon-Y294A is most prone to autolysis. Slight autolysis of the intact enzyme and the mutant forms of Lon-R164A and Lon-R192A is observed only in the absence of nucleotides
additional information
-
analysis of the propensity of C-His-Lon and mutant enzymes Lon-R164A, Lon-R192A, and Lon-Y294A for autodegradation reveals that Lon-Y294A is most prone to autolysis. Slight autolysis of the intact enzyme and the mutant forms of Lon-R164A and Lon-R192A is observed only in the absence of nucleotides
additional information
construction of a recombinant form des-CC(G5)-Lon in which the deleted CC fragment, a deleted 108-unit coiled-coil fragment (residues M173-M280) is replaced by a pentaglycine peptide, the the ClpB chaperone of Thermus thermophilus. Analysis of enzymatic properties of des-CC(G5)-Lon-H6 (DELTArLon) mutant, overview. In the absence of nucleotide effectors as well as in the presence of free nucleotides or the ADP-Mg complex, casein is not hydrolyzed by rLon even if the duration of the experiment is increased many times. The deletion form DELTArLon is incapable of hydrolyzing beta-casein in the time interval in which the proteolytic activity of full-length rLon protease is tested
additional information
construction of an N-terminally truncated ClpX lacking residues 1-62, ClpXDELTAN
additional information
-
generation of mutant LonDELTANP lacking the ATP domain. Deletion of Lon's ATPase domain abrogates interactions with DNA. The DNA-binding defect of Lon protease affects TrfA proteolysis. And the Lon mutants are defective in proper cellular localization, most probably due to their impaired ability to form a nucleoprotein complex
additional information
removal of the HI(CC) domain, deletion of the HI(CC) domain leads to a complete loss of the proteolytic activity towards beta-casein by the deletion form. The deletion form Lon-dHI(CC) is unstable and it undergoes autolysis both in the absence and presence of nucleotide effectors, the autolysis of Lon-dHI(CC) is most pronounced in the presence of Mg2+ ions
additional information
-
removal of the HI(CC) domain, deletion of the HI(CC) domain leads to a complete loss of the proteolytic activity towards beta-casein by the deletion form. The deletion form Lon-dHI(CC) is unstable and it undergoes autolysis both in the absence and presence of nucleotide effectors, the autolysis of Lon-dHI(CC) is most pronounced in the presence of Mg2+ ions
additional information
-
lon mutant, confers partial resistance against colicin. Sensitivity of lon mutant to colicin can be rescued by complementation. Decrease in the protein expression levels of BtuB and OmpF in the lon mutant, which are involved in colicin translocation. Elevation of expression of the oxyS gene, which can negatively control on the expression of BtuB protein
-
additional information
-
lon- mutant, steroidogenic acute regulatory protein turnover is blocked
additional information
-
lon-depleted cells show little if any mitochondrial DNA damage
additional information
-
total loss of lon activity leads to apoptosis
additional information
-
homozygous deletion of gene Lonp1
additional information
construction of a hLon mutant lacking the first 156 amino acids, the mutant's enzymatic activities and its 3D structure are severely disturbed
additional information
-
construction of a hLon mutant lacking the first 156 amino acids, the mutant's enzymatic activities and its 3D structure are severely disturbed
additional information
generation of deletion mutations MtaLonCdelta (removing residues 506-511) and MtaLonCDELTAHHE (replacing residues 118-205 with a triglycine linker) by a PCR-based strategy
additional information
-
generation of deletion mutations MtaLonCdelta (removing residues 506-511) and MtaLonCDELTAHHE (replacing residues 118-205 with a triglycine linker) by a PCR-based strategy
additional information
generation of truncated enzyme versions, AAAP(residues 295-793) and AP(residues 492-793)
additional information
-
several truncated constructs of Meiothermus taiwanensis LonA (MtaLonA) without the LAN domain are prepared for crystallization. The DELTAhairpin mutant loses allosteric stimulation of ATPase activity by substrate or inhibitor. DELTALoop-2 mutant, which can degrade casein but has a defective Ig2-translocating activity, shows a wild-type-like ATPase stimulation by casein, but the mutant exhibits a severely reduced ATPase allostery by Ig2
additional information
homozygous deletion of gene Lonp1
additional information
-
attempts to construct a lonV mutant fail, lonD mutants are unable to sporulate
additional information
-
mini-Tn5lacZ1 transposon insertion in the Lon protease gene confers a hyper-swarming phenotype on Proteus mirabilis. The lon mutation increases the accumulation of mRNA for representative class 1, flhDC, class 2, fliA, and class 3, flaA genes during swarmer cell differentiation. In addition, the stability of the FlhD protein is fourfold higher in the lon::mini-Tn5lacZ1 background. Expression of a single-copy lon::lacZ fusion increases during the swarming cycle and reaches peak levels of expression at a point just after swarmer cell differentiation has initiated. In liquid media, the lon::mini-Tn5lacZ1 insertion results in motile, highly elongated cells that overexpress flagellin. The lon::mini-Tn5lacZ1 mutation results in increased expression of the hpmBA and zapA virulence genes during swarmer cell differentiation
additional information
-
lon mutants show impaired motility compared to the wild-type and a defect in biofilm formation
additional information
-
mutants in PA1803, a close homolog of the ATP-dependent lon protease, exhibit more than 4fold-increased susceptibilities to ciprofloxacin and 2fold more susceptibilities to norfloxacin and nalidixic acid, but not to gentamicin or imipenem, as well as a characteristic elongated morphology. Complementation of the lon mutant restores wild-type antibiotic susceptibility and cell morphology
additional information
-
construction of quorum-sensing signaling system mutant strains, gene lon disrupted cells of mutant strain, CS9008 overproduce pyocyanin, the biosynthesis of which depends on the RhlR/RhlI system, and show increased levels of a transcriptional regulator RhlR, phenotype, overview
additional information
construction of quorum-sensing signaling system mutant strains, gene lon disrupted cells of mutant strain, CS9008 overproduce pyocyanin, the biosynthesis of which depends on the RhlR/RhlI system, and show increased levels of a transcriptional regulator RhlR, phenotype, overview
additional information
-
cells with Lon protease gene disruption overproduce pyocyanin and show increased levels of transcriptional regulator RhlR and increased expression of LasR/LasI. Regulation of RhlR/RhlI by Lon is independent of LasR/LasI
additional information
cells with Lon protease gene disruption overproduce pyocyanin and show increased levels of transcriptional regulator RhlR and increased expression of LasR/LasI. Regulation of RhlR/RhlI by Lon is independent of LasR/LasI
additional information
Pseudomonas protegens CHA1321(pycA-)/pME7402 is mutagenized by inserting transposon Tn5 in a mating with Escherichia coli W3110/pLG221. Complementation of the lon-negative mutant
additional information
-
Pseudomonas protegens CHA1321(pycA-)/pME7402 is mutagenized by inserting transposon Tn5 in a mating with Escherichia coli W3110/pLG221. Complementation of the lon-negative mutant
additional information
-
Pseudomonas protegens CHA1321(pycA-)/pME7402 is mutagenized by inserting transposon Tn5 in a mating with Escherichia coli W3110/pLG221. Complementation of the lon-negative mutant
-
additional information
lon mutant, acyl homoserine lactone levels, PpuR levels and ppuI promoter activity all increase significantly
additional information
-
lon mutant, acyl homoserine lactone levels, PpuR levels and ppuI promoter activity all increase significantly
additional information
-
lon mutant, acyl homoserine lactone levels, PpuR levels and ppuI promoter activity all increase significantly
-
additional information
-
lon mutants, constitutively express the hrp regulon, hypersecrete effector proteins
additional information
-
lon- mutant, most genes induced in the mutant belong to the HrpL regulon or are related to transcription, protein synthesis, and energy metabolism. A major group of genes reduced in the mutant are related to cell wall biogenesis. Exhibits elevated hrpL expression in rich medium Kings B, but reduced hrpL expression in minimal medium. Reduced hrpL RNA is correlated with reduced hrpR and hrpS RNAs. Shows reduced bacterial pathogenicity
additional information
-
the lon protease of Pyrococcus abyssi is interupted by an intein. The intein splices essentially to completion when over-expressed in Escherichia coli. Blocking the first step of splicing with a Cys1 to Ala mutation or step two of splicing with a Ser+1 to Ala mutation leads to the accumulation of precursor. Substitution of Ser+1 with Thr results in precursor, whereas substitution to Cys results in efficient splicing. The influence of the flanking extein residues on splicing efficiency is as follows. Mutation of Gly+2, Gly+3, Gly+5 or Gly+2/Gly+3 to Ala results mostly in splicing, but mutation of Gly+2 also results in the accumulation of branched-ester intermediate. The identity of the C-terminal residue of the N-extein seems less important, as mutation of Gln1 to Asn, Ala, Glu or Gly results in efficient splicing
additional information
-
absence of lon, results in a lack of ATP-dependent proteolysis in the mitochondrial matrix, accumulation of electron dense aggregates and large mitochondrial DNA deletions. Mutant lacking both ATPase and protease activity also fails to suppress COX assembly defects
additional information
-
Pim1 mutants, are respiratory-deficient and unable to grow on non-fermentable carbon sources
additional information
-
lon mutants, accumulate abnormal proteins
additional information
-
lon mutants, are unable to survive and proliferate murine macrophages, are extremely susceptible to hydrogen peroxide
additional information
deletion mutant lacking the putative membrane-anchoring region, residues 134-170, and introduction of mutations S523A and K566A to avoid self-degrading activity. Mutant is active for peptide cleavage and both ATP-dependent and -independent protein degradation
additional information
-
generation of a single-deletion Lon mutant by gene replacement, DELTAMLon showing decreased production of conidia but increased growth of mycelia
additional information
-
generation of a single-deletion Lon mutant by gene replacement, DELTAPLon showing increased production of conidia but decreased growth of mycelia
additional information
-
generation of a single-deletion Lon mutant by gene replacement, DELTAMLon showing decreased production of conidia but increased growth of mycelia
-
additional information
-
generation of a single-deletion Lon mutant by gene replacement, DELTAPLon showing increased production of conidia but decreased growth of mycelia
-
additional information
-
Walker A and B motifs, and the sensor 1 and sensor 2 are essential for the ATPase activity, while sensor 2 and the arginine finger are involved in activation of the protease domain
additional information
-
lonS mutants, constitutively differentiated in the swarmer mode
additional information
-
enzyme and protease ClpXP deletion mutant, no expression of a functional type II secretion system partly because of high cytosolic levels of small histone-like protein YmoA
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.