Literature summary for 3.4.21.53 extracted from

Chen, S.H.; Suzuki, C.K.; Wu, S.H.
Thermodynamic characterization of specific interactions between the human Lon protease and G-quartet DNA (2008), Nucleic Acids Res., 36, 1273-1287.

Search for more literature for 3.4.21.53

Organism

Organism	UniProt	Comment	Textmining
Homo sapiens	-	-	-

Subunits

Subunits	Comment	Organism
More	Lon protease specifically binds single stranded DNAs with a propensity for forming parallel G-quartets. Lon binding to the 24-base oligomer LSPas, AATAATGTGTTAGTTGGGGGGTGA is primarily driven by enthalpy change associated with a significant reduction in heat capacity. The Lon-LSPas complex shows a considerable enhancement in thermal stability. Lon binding to an 8-base G-rich core sequence, TG6T is entropically driven with a relatively negligible change in heat capacity	Homo sapiens

Use of this online version of BRENDA is free under the CC BY 4.0 license. See terms of use for full details.

Release 2023.1 (January 2023)