EC Number   |
Substrates |
Organism |
Products |
Reversibility |
|---|
   4.6.1.22 | 20 nt RNA + H2O |
32pUGGUGGUGGAUCCCGGGAUC, exoribonuclease activity |
Bacillus subtilis |
? |
- |
? |
| 4.6.1.22 | 30 nt RNA |
- |
Bacillus subtilis |
? |
- |
? |
| 4.6.1.22 | 30 nt RNA + H2O |
RT-FeDEx assay of RNase J1, J2 and the RNase J1/J2 complex, 30 nt RNA labelled with a carboxyfluorescein group at its 3'-end and hybridized to a 17 nt DNA bearing a 5'-quenching group carboxymethylrhodamine, exoribonuclease activity |
Bacillus subtilis |
? |
- |
? |
| 4.6.1.22 | 350 nt RNA + H2O |
5'-triphosphate-labelled 350 nt fragment corresponding to the Bacillus subtilis thrS leader mRNA and 46 nts of coding sequence, and a 570 nt fragment corresponding to the hbs P3 transcript, endonucleolytic activity |
Bacillus subtilis |
? |
- |
? |
| 4.6.1.22 | DELTAermC mRNA + H2O |
DELTAermC mRNA decay is RNase J1 dependent. Decay-initiating endonuclease cleavage can occur at several sites near the 3' end. Preferred RNase J1 target sites are located in the downstream half of DELTAermC mRNA, located upstream of eSL1 (ermC stem-loop 1), between eSL1 and eSL2, and between eSL2 and the 3' transcription terminator. The putative endonuclease cleavages in the body of the message are not dependent on ribosome flow. Even in the absence of these sites, stability is further increased in a strain with reduced RNase J1, suggesting alternate pathways for decay that can include exonucleolytic decay from the 5' end |
Bacillus subtilis |
? |
- |
? |
| 4.6.1.22 | more |
single-turnover kinetic assays are performed using 32P-labeled pre-tRNAAsp, containing a 14-nucleotide leader sequence, as a substrate |
Bacillus subtilis |
? |
- |
? |
| 4.6.1.22 | more |
enzyme RNase J1 possesses 5'-to-3' exoribonuclease activity, while enzymes RNase J1 and RNase J2 form a complex that also has endonuclease activity, model for the degradation of the trp leader mRNA bound to TRAP. RNase J1 is the endonuclease cleaving scRNA that is 4 nts shorter on the 3' end |
Bacillus subtilis |
? |
- |
? |
| 4.6.1.22 | more |
ribonucleases J1 and J2 have both endoribonucleolytic and 5'-to-3' exoribonucleolytic activities. Both act on class I and class II mRNAs, overview |
Streptococcus pyogenes |
? |
- |
? |
| 4.6.1.22 | more |
RNase J is a bifunctional 5'-3' exo/endoribonuclease |
Bacillus subtilis |
? |
- |
? |
| 4.6.1.22 | more |
RNase J is a bifunctional 5'-3' exo/endoribonuclease, structure of enzyme bound to a 4-nucleotide RNA showing an RNA-binding channel. A second, negatively charged tunnel leads from the active site, and is ideally located to evacuate the cleaved nucleotide in 5'-3' exonucleolytic mode |
Thermus thermophilus |
? |
- |
? |
