Any feedback?
Please rate this page
(literature.php)
(0/150)

BRENDA support

Literature summary for 3.4.24.69 extracted from

  • Chang, T.W.; Blank, M.; Janardhanan, P.; Singh, B.R.; Mello, C.; Blind, M.; Cai, S.
    In vitro selection of RNA aptamers that inhibit the activity of type A botulinum neurotoxin (2010), Biochem. Biophys. Res. Commun., 396, 854-860.
    View publication on PubMedView publication on EuropePMC
Search for more literature for 3.4.24.69

Application

Application Comment Organism
drug development RNA aptamers are a unique group of molecules acting as therapeutics and as an antidote against botulism Clostridium botulinum
medicine RNA aptamers are a unique group of molecules acting as therapeutics and as an antidote against botulism Clostridium botulinum

Inhibitors

Inhibitors Comment Organism Structure
additional information identification of three RNA aptamers from a ssDNA random library through SELEX-process, which bind strongly to the light chain of type A BoNT and inhibit the endopeptidase activity, with IC50 in low nM range. Inhibition kinetic studies reveal low nM KI and non-competitive nature of their inhibition, enzyme docking study, and inhibition kinetics, overview Clostridium botulinum
S132B-C11 a RNA aptamer that inhibits the enzyme's endopeptidase activity in a non-competitive manner. The core sequence is GACAGCGUGCCUAGAAGUCCAAGCUUAAAUAACCACGCUCGACAAGC, structure, overview Clostridium botulinum
S132B-C12 a RNA aptamer that inhibits the enzyme's endopeptidase activity in a non-competitive manner. The core sequence is ACAACCCGGAACAACGUCUAACAGUGUACCAUAACCCGGCAUUCA, structure, overview Clostridium botulinum
S132B-C22 a RNA aptamer that inhibits the enzyme's endopeptidase activity in a non-competitive manner. The core sequence is AUUCGGGCCCAGGAACCAACUAUAUAAAUGUCCCGAAUGCUUCGACG, structure, overview Clostridium botulinum

Metals/Ions

Metals/Ions Comment Organism Structure
Zn2+ a zinc-metallopeptidase Clostridium botulinum

Molecular Weight [Da]

Molecular Weight [Da] Molecular Weight Maximum [Da] Comment Organism
150000
-
-
 Clostridium botulinum

Organism

Organism UniProt Comment Textmining
Clostridium botulinum
-
-
-

Subunits

Subunits Comment Organism
More BoNTs are proteins comprised of three functional domains, the light chains, LCs, the heavy chain, HC, and the translocation HN of the LC into the cell cytoplasm Clostridium botulinum

Synonyms

Synonyms Comment Organism
BoNT
-
 Clostridium botulinum
BoNT/A
-
 Clostridium botulinum
type A BoNT
-
 Clostridium botulinum
type A botulinum neurotoxin
-
 Clostridium botulinum

General Information

General Information Comment Organism
malfunction the endopeptidase activity of light chain domain of BoNT causes inhibition of the neurotransmitter release and the flaccid paralysis that leads to lethality in botulism in the host Clostridium botulinum