Inhibitors | Comment | Organism | Structure |
---|---|---|---|
CCACCAACACAACTAAACTCCAC | inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 4.5% inhibition (2 nM inhibitor /2 nM cathepsin E) | Rattus norvegicus | |
CCACCACCACAACAAAACTCCAC | inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 31.0% inhibition (2 nM inhibitor /2 nM cathepsin E) | Rattus norvegicus | |
CCACCACCACAACGAAACTCCAC | inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 14.0% inhibition (2 nM inhibitor /2 nM cathepsin E) | Rattus norvegicus | |
CCACCACCACAATAAAACTCCAC | inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 33.5% inhibition (2 nM inhibitor /2 nM cathepsin E) | Rattus norvegicus | |
CCATCACTACAACAAAACTCCAC | inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 11.0% inhibition (2 nM inhibitor /2 nM cathepsin E) | Rattus norvegicus | |
CCCATAGGGATCACTCCCTCCAC | inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 22.3% inhibition (2 nM inhibitor /2 nM cathepsin E) | Rattus norvegicus | |
CCCATAGTGCTCACTCCCTCCAC | inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 6.2% inhibition (2 nM inhibitor /2 nM cathepsin E) | Rattus norvegicus | |
CCCCCACCACAACCCTCCCTCCAC | inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 37.6% inhibition (2 nM inhibitor /2 nM cathepsin E) | Rattus norvegicus | |
CCCCCACCACAACCCTCCTCCAC | inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 33.3% inhibition (2 nM inhibitor /2 nM cathepsin E) | Rattus norvegicus | |
TCCATAAGGATCACTCCCTCCAC | inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 23.2% inhibition (2 nM inhibitor /2 nM cathepsin E) | Rattus norvegicus | |
TCCATAGGAATCACTCCCTCCAC | inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 26.8% inhibition (2 nM inhibitor /2 nM cathepsin E) | Rattus norvegicus | |
TCCATAGGGATTCACTCCTCCAC | inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 17.7% inhibition (2 nM inhibitor /2 nM cathepsin E) | Rattus norvegicus | |
TCCATAGGGCTCACTCCCTCCAC | inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 24.0% inhibition (2 nM inhibitor /2 nM cathepsin E) | Rattus norvegicus | |
TCCATAGGGTCACTCCTCCAC | inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 18.4% inhibition (2 nM inhibitor /2 nM cathepsin E) | Rattus norvegicus | |
TCCATAGGTATCACTCCCTCCAC | inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 17.8% inhibition (2 nM inhibitor /2 nM cathepsin E) | Rattus norvegicus | |
TCCATCGGGATCACTCCCTCCAC | inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 15.4% inhibition (2 nM inhibitor /2 nM cathepsin E) | Rattus norvegicus | |
TCCCCGGAGCTCACTCATCCAC | inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 27.0% inhibition (2 nM inhibitor /2 nM cathepsin E) | Rattus norvegicus | |
TCCCCGGAGCTCACTCCAC | inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 11.5% inhibition (2 nM inhibitor /2 nM cathepsin E) | Rattus norvegicus | |
TCCCCGGTGCTCACTTATCCAC | inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 19.3% inhibition (2 nM inhibitor /2 nM cathepsin E) | Rattus norvegicus | |
TGCATCGGGATCACTCCCTCCAC | inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 40.8% inhibition (2 nM inhibitor /2 nM cathepsin E) | Rattus norvegicus | |
TTCATATGGATCACTCCCTCCAC | inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 23.0% inhibition (2 nM inhibitor /2 nM cathepsin E) | Rattus norvegicus | |
TTCATCGGGATCACTCCCTCCAC | inhibitory part, additionally the molecule has the conserved sequence GATCTCACTCCTTCGCAGTATTCGCGAGCC at its 5'-side, 29.7% inhibition (2 nM inhibitor /2 nM cathepsin E) | Rattus norvegicus |
Organism | UniProt | Comment | Textmining |
---|---|---|---|
Rattus norvegicus | - |
- |
- |
Source Tissue | Comment | Organism | Textmining |
---|---|---|---|
spleen | - |
Rattus norvegicus | - |
Substrates | Comment Substrates | Organism | Products | Comment (Products) | Rev. | Reac. |
---|---|---|---|---|---|---|
MOCAc-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(Dnp)-D-Arg-NH2 + H2O | - |
Rattus norvegicus | ? | - |
? |
Synonyms | Comment | Organism |
---|---|---|
cathepsin E | - |
Rattus norvegicus |