Organism | UniProt | Comment | Textmining |
---|---|---|---|
Homo sapiens | - |
- |
- |
Subunits | Comment | Organism |
---|---|---|
More | Lon protease specifically binds single stranded DNAs with a propensity for forming parallel G-quartets. Lon binding to the 24-base oligomer LSPas, AATAATGTGTTAGTTGGGGGGTGA is primarily driven by enthalpy change associated with a significant reduction in heat capacity. The Lon-LSPas complex shows a considerable enhancement in thermal stability. Lon binding to an 8-base G-rich core sequence, TG6T is entropically driven with a relatively negligible change in heat capacity | Homo sapiens |