BRENDA - Enzyme Database
show all sequences of

Inhibition of thrombin activity with DNA-aptamers

Dobrovolsky, A.B.; Titaeva, E.V.; Khaspekova, S.G.; Spiridonova, V.A.; Kopylov, A.M.; Mazurov, A.V.; Bull. Exp. Biol. Med. 148, 33-36 (2009)

Data extracted from this reference:

additional information
the DNA aptamers 15TBA (GGTTGGTGTGGTTGG) and 31TBA (CACTGGTAGGTTGGTGTGGTTGGGGCCAGTG) added to human plasma dose-dependently increase fibrin formation upon exposure to exogenous thrombin, clotting activation by the extrinsic pathway, and activated partial clotting activation by the intrinsic pathway. At the same time, these aptamers do not modify amidolytic activity of thrombin
Homo sapiens
Natural Substrates/ Products (Substrates)
Natural Substrates
Commentary (Nat. Sub.)
Natural Products
Commentary (Nat. Pro.)
Organism (Nat. Pro.)
fibrinogen + H2O
Homo sapiens
fibrin + fibrinopeptide A + fibrinopeptide B
Primary Accession No. (UniProt)
Homo sapiens
Source Tissue
Source Tissue
blood plasma
Homo sapiens
Substrates and Products (Substrate)
Commentary Substrates
Literature (Substrates)
Commentary (Products)
Literature (Products)
Organism (Products)
fibrinogen + H2O
Homo sapiens
fibrin + fibrinopeptide A + fibrinopeptide B
tosyl-Gly-L-Pro-L-Arg-4-nitroanilide + H2O
Homo sapiens
tosyl-Gly-L-Pro-L-Arg + 4-nitroaniline
Inhibitors (protein specific)
additional information
the DNA aptamers 15TBA (GGTTGGTGTGGTTGG) and 31TBA (CACTGGTAGGTTGGTGTGGTTGGGGCCAGTG) added to human plasma dose-dependently increase fibrin formation upon exposure to exogenous thrombin, clotting activation by the extrinsic pathway, and activated partial clotting activation by the intrinsic pathway. At the same time, these aptamers do not modify amidolytic activity of thrombin
Homo sapiens
Natural Substrates/ Products (Substrates) (protein specific)
Natural Substrates
Commentary (Nat. Sub.)
Natural Products
Commentary (Nat. Pro.)
Organism (Nat. Pro.)
fibrinogen + H2O
Homo sapiens
fibrin + fibrinopeptide A + fibrinopeptide B
Source Tissue (protein specific)
Source Tissue
blood plasma
Homo sapiens
Substrates and Products (Substrate) (protein specific)
Commentary Substrates
Literature (Substrates)
Commentary (Products)
Literature (Products)
Organism (Products)
fibrinogen + H2O
Homo sapiens
fibrin + fibrinopeptide A + fibrinopeptide B
tosyl-Gly-L-Pro-L-Arg-4-nitroanilide + H2O
Homo sapiens
tosyl-Gly-L-Pro-L-Arg + 4-nitroaniline
Other publictions for EC
1st author
Pub Med
Activating Compound
Crystallization (Commentary)
General Stability
KM Value [mM]
Molecular Weight [Da]
Natural Substrates/ Products (Substrates)
Organic Solvent Stability
Oxidation Stability
Posttranslational Modification
Purification (Commentary)
Renatured (Commentary)
Source Tissue
Specific Activity [micromol/min/mg]
Storage Stability
Substrates and Products (Substrate)
Temperature Optimum [°C]
Temperature Range [°C]
Temperature Stability [°C]
Turnover Number [1/s]
pH Optimum
pH Range
pH Stability
Ki Value [mM]
pI Value
IC50 Value
Activating Compound (protein specific)
Application (protein specific)
Cloned(Commentary) (protein specific)
Cofactor (protein specific)
Crystallization (Commentary) (protein specific)
Engineering (protein specific)
General Stability (protein specific)
IC50 Value (protein specific)
Inhibitors (protein specific)
Ki Value [mM] (protein specific)
KM Value [mM] (protein specific)
Localization (protein specific)
Metals/Ions (protein specific)
Molecular Weight [Da] (protein specific)
Natural Substrates/ Products (Substrates) (protein specific)
Organic Solvent Stability (protein specific)
Oxidation Stability (protein specific)
Posttranslational Modification (protein specific)
Purification (Commentary) (protein specific)
Renatured (Commentary) (protein specific)
Source Tissue (protein specific)
Specific Activity [micromol/min/mg] (protein specific)
Storage Stability (protein specific)
Substrates and Products (Substrate) (protein specific)
Subunits (protein specific)
Temperature Optimum [°C] (protein specific)
Temperature Range [°C] (protein specific)
Temperature Stability [°C] (protein specific)
Turnover Number [1/s] (protein specific)
pH Optimum (protein specific)
pH Range (protein specific)
pH Stability (protein specific)
pI Value (protein specific)
General Information
General Information (protein specific)
Expression (protein specific)
KCat/KM [mM/s]
KCat/KM [mM/s] (protein specific)
Highly specific detection of t ...
Homo sapiens
Multiple inhibitory kinetics r ...
Homo sapiens
Thromb. Res.
Bovine thrombin enhances the e ...
Bos taurus
Identification of structural-k ...
Homo sapiens
Ligand binding to anion-bindin ...
Homo sapiens
J. Biol. Chem.
Kinetic characterization of in ...
Homo sapiens
Anal. Biochem.
P3-P3' residues flanking sciss ...
Homo sapiens
The extended cleavage specific ...
Homo sapiens
Structure-activity studies and ...
Homo sapiens
Antimicrob. Agents Chemother.
Application of immobilized thr ...
Bos taurus
Appl. Microbiol. Biotechnol.
High glucose enhances thrombin ...
Homo sapiens
Arterioscler. Thromb. Vasc. Biol.
Thrombin induces MCP-1 express ...
Homo sapiens
Biochem. Biophys. Res. Commun.
Thrombin activation of PI3K/PD ...
Rattus norvegicus
Biochim. Biophys. Acta
Synthesis and biochemical eval ...
Homo sapiens
Bioorg. Med. Chem. Lett.
Polyphosphate is a cofactor fo ...
Homo sapiens
Highly efficient control of th ...
Homo sapiens
Thrombin induces NF-kappaB act ...
Bos taurus, Homo sapiens
J. Biol. Chem.
Crystal structure of thrombin ...
Homo sapiens
Thrombin stimulates RPE cell p ...
Homo sapiens
J. Cell. Physiol.
Brain endothelial cells synthe ...
Homo sapiens, Rattus norvegicus
Am. J. Pathol.
Thrombin induces endothelial a ...
Rattus norvegicus
Am. J. Physiol. Cell Physiol.
Graphene fluorescence resonanc ...
Homo sapiens
Anal. Chem.
Is increased thrombin activati ...
Homo sapiens
A sensitive HIV-1 envelope ind ...
Homo sapiens
Biochem. Biophys. Res. Commun.
Thrombin promotes proinflammat ...
Homo sapiens
Biochem. Biophys. Res. Commun.
The effect of immobilization o ...
Homo sapiens
Thrombin activation of protein ...
Bos taurus
Br. J. Pharmacol.
Thrombin facilitates invasion ...
Homo sapiens
Cancer Immunol. Immunother.
Role of thrombin as a tumor gr ...
Homo sapiens
Cell Cycle
Effects of AZD0837, a novel di ...
Homo sapiens
Clin. Drug Investig.
Granzyme A and thrombin differ ...
Homo sapiens
Preparation of chondroitin sul ...
Bos taurus
Glycoconj. J.
Direct thrombin inhibitors: ph ...
Homo sapiens
Intensive Care Med.
Crystal structure of thrombin ...
Homo sapiens
J. Biol. Chem.
Thrombin and collagen induce a ...
Homo sapiens
J. Biol. Chem.
Sucrose octasulfate selectivel ...
Homo sapiens
J. Biol. Chem.
Inhibition of thrombin formati ...
Bos taurus
J. Biol. Chem.
Thrombin enhanced migration an ...
Homo sapiens
J. Cell. Physiol.
Thrombin down-regulates the TG ...
Homo sapiens
J. Cell. Physiol.
Screening of benzamidine-based ...
Homo sapiens
J. Comput. Aided Mol. Des.
Discovery and clinical evaluat ...
Homo sapiens
J. Med. Chem.
Enhancement of hydrophobic int ...
Homo sapiens
J. Med. Chem.
Cleavage-sensing redox peptide ...
Homo sapiens
Degeneration of dopaminergic n ...
Homo sapiens
Proteolysis of human thrombin ...
Homo sapiens
PLoS Pathog.
Functional identification of n ...
Homo sapiens
Rejuvenation Res.
An aptamer-based assay for thr ...
Homo sapiens
Thrombin and activated protein ...
Homo sapiens
Thromb. Res.
The influence of direct thromb ...
Homo sapiens
Thromb. Res.
A new type of thrombin inhibit ...
Bos taurus, Homo sapiens
Russo Krauss
Crystallization and preliminar ...
Homo sapiens
Acta Crystallogr. Sect. F
Engineering thrombin for selec ...
Homo sapiens
J. Biol. Chem.
Thrombin stimulation of proteo ...
Homo sapiens
J. Biol. Chem.
Thrombin-dependent NF-kappaB a ...
Mus musculus
J. Biol. Chem.
The mechanism of melanoma-asso ...
Homo sapiens
J. Invest. Dermatol.
Thrombin and trypsin directly ...
Bos taurus
J. Physiol.
A series of natural flavonoids ...
Bos taurus
Thromb. Res.
Electrostatic interaction base ...
Homo sapiens
Anal. Chem.
Vitamin K deficiency amplifies ...
Rattus norvegicus
Ann. Hematol.
Thrombin fragment (TP508) decr ...
Sus scrofa
Ann. Thorac. Surg.
Click-chemistry-conjugated oli ...
Homo sapiens
Thrombin induces tumor cell cy ...
Homo sapiens
Cancer Res.
Thrombin induces nestin expres ...
Rattus norvegicus
Cell. Signal.
Citrullinated fibrinogen shows ...
Homo sapiens
Clin. Chim. Acta
Pomegranate fruit components m ...
Homo sapiens
Oral thrombin inhibitor dabiga ...
Homo sapiens
J. Arthroplasty
Concentration dependent dual e ...
Homo sapiens
J. Cell. Physiol.
Highly sensitive detection of ...
Homo sapiens
J. Chromatogr. A
Hemalin, a thrombin inhibitor ...
Bos taurus
J. Insect Physiol.
Functional analysis of mutant ...
Homo sapiens
J. Thromb. Haemost.
Modulation of human uterine sm ...
Homo sapiens
Reprod. Biol. Endocrinol.
Thrombin inhibition by argatro ...
Rattus norvegicus
De Smedt
The technique of measuring thr ...
Homo sapiens
Thromb. Haemost.
Thrombin inhibits nuclear fact ...
Homo sapiens
Thromb. Haemost.
Microparticle-linked tissue fa ...
Homo sapiens
Thromb. Haemost.
Ben Mansour
Mechanism of thrombin inhibiti ...
Homo sapiens
Thromb. Res.
Implementation of a collaborat ...
Homo sapiens
Am. J. Health Syst. Pharm.
The first two Japanese cases o ...
Homo sapiens
Am. J. Hematol.
[Heparin-induced thrombocytope ...
Homo sapiens
Dabigatran, a direct thrombin ...
Homo sapiens
Arthritis Rheum.
Thrombin regulates matrix meta ...
Homo sapiens
Biochem. Biophys. Res. Commun.
Early intraplatelet signaling ...
Homo sapiens
Proton bridging in the interac ...
Homo sapiens
Mutagenesis studies toward und ...
Homo sapiens
Structural and thermodynamic a ...
Homo sapiens
Biochim. Biophys. Acta
First steps in the direction o ...
Homo sapiens
Bioorg. Med. Chem. Lett.
Thrombin: A potential regulato ...
Homo sapiens
Biosci. Hypotheses
Thrombin induces the expressio ...
Homo sapiens
Oxidative modification of fibr ...
Homo sapiens
Bull. Exp. Biol. Med.
Inhibition of thrombin activit ...
Homo sapiens
Bull. Exp. Biol. Med.
Effect of iron ions on functio ...
Homo sapiens
Bull. Exp. Biol. Med.
Comparison of immunogenic pote ...
Bos taurus
Clin. Appl. Thromb. Hemost.
Relative purity of different b ...
Bos taurus
Clin. Appl. Thromb. Hemost.
Pharmacology, pharmacokinetics ...
Homo sapiens
Clin. Appl. Thromb. Hemost.
Direct Factor Xa and direct th ...
Homo sapiens
Curr. Opin. Drug Discov. Devel.
Oral direct thrombin inhibitor ...
Homo sapiens
Eur. Heart J.
New direct thrombin inhibitors ...
Homo sapiens
Intern. Emerg. Med.
Mechanism of the anticoagulant ...
Homo sapiens, Mus musculus
J. Biol. Chem.
Long range communication betwe ...
Homo sapiens
J. Biol. Chem.
Mutant N143P reveals how Na+ a ...
Homo sapiens
J. Biol. Chem.
Compounds binding to the S2-S3 ...
Homo sapiens
J. Med. Chem.
Think twice: understanding the ...
Homo sapiens
J. Mol. Biol.
Effect of thrombin and bradyki ...
Homo sapiens
J. Mol. Recognit.
Coagulation factor Xa activate ...
Mus musculus
J. Neurochem.
Real-time monitoring of cAMP l ...
Homo sapiens
J. Physiol.
Thrombin stimulates mitogenesi ...
Homo sapiens
Neurosci. Lett.
Is thrombin generation the new ...
Homo sapiens
Pharmacol. Res.
In retinal vein occlusion plat ...
Homo sapiens
Thromb. Res.
beta2-Glycoprotein I protects ...
Homo sapiens
Arthritis Rheum.
Electrochemical detection of t ...
Homo sapiens
Design, synthesis, and thrombi ...
Homo sapiens
Bioorg. Med. Chem. Lett.
Different approaches for the d ...
Homo sapiens
Biosens. Bioelectron.
Activation of protease-activat ...
Rattus norvegicus
Brain Res. Bull.
Minimally invasive therapy of ...
Homo sapiens
Cardiovasc. Intervent. Radiol.
Carbonylation of platelet prot ...
Homo sapiens, Mesocricetus auratus, Rattus norvegicus
Clin. Chem. Lab. Med.
Prediction of recurrent venous ...
Homo sapiens
Clin. Chem.
Phase 3, randomized, double-bl ...
Bos taurus, Homo sapiens
Curr. Med. Res. Opin.
Control of thrombin signaling ...
Mus musculus
J. Cell Sci.
Over-expression of the thrombi ...
Homo sapiens
J. Matern. Fetal. Neonatal. Med.
Novel potent and selective thr ...
Homo sapiens
J. Med. Chem.
Proteomic analysis of the porc ...
Sus scrofa
J. Proteomics
Thrombin induces activation an ...
Homo sapiens
J. Thromb. Haemost.
Anticoagulant characteristics ...
Homo sapiens
J. Thromb. Haemost.
A comparison of direct thrombi ...
Homo sapiens
J. Thromb. Thrombolysis
A novel hirudin derivative cha ...
Oryctolagus cuniculus
J. Thromb. Thrombolysis
Aptamer-based SERRS sensor for ...
Homo sapiens
Nano Lett.
Protease activated receptor 1 ...
Homo sapiens
Thromb. Haemost.
Large-scale preparation of thr ...
Homo sapiens
Thromb. Res.
Further characterization of AD ...
Homo sapiens
J. Thromb. Haemost.
Influence of thrombin concentr ...
Rattus norvegicus
Acta Biomater.
Employing mutants to study thr ...
Homo sapiens
Crystal structure of thrombin ...
Homo sapiens
Biophys. Chem.
Mechanism of Na+ binding to th ...
Homo sapiens
Biophys. Chem.
The ligand occupancy of endoth ...
Homo sapiens
Thrombin bound to a fibrin clo ...
Homo sapiens
J. Cell. Mol. Med.
Design and X-ray crystal struc ...
Homo sapiens
Crystal structures of murine t ...
Mus musculus
Proc. Natl. Acad. Sci. USA
Crystallization and preliminar ...
Bos taurus
Protein Pept. Lett.
Preparation and characterizati ...
Homo sapiens
Transfus. Med.
Fibrinogen substrate recogniti ...
Homo sapiens
J. Biol. Chem.
Murine thrombin lacks Na+ acti ...
Homo sapiens, Mus musculus
J. Biol. Chem.
The transferable tail: fusion ...
Homo sapiens
High resolution crystal struct ...
Homo sapiens
Biophys. Chem.
Specific determination of plas ...
Homo sapiens
Clin. Appl. Thromb. Hemost.
Galectin-8 and galectin-9 are ...
Homo sapiens
Crystal structure of thrombin ...
Homo sapiens
J. Biol. Chem.
A control switch for prothromb ...
Homo sapiens
J. Biol. Chem.
Rapid kinetics of Na+ binding ...
Homo sapiens
J. Biol. Chem.
De Filippis
Effect of Na+ binding on the c ...
Homo sapiens
Biochem. J.
Crystal structure of wild-type ...
Homo sapiens
Biochem. J.
Thrombin induces DNA synthesis ...
Bos taurus
Biochem. Pharmacol.
Thrombin-catalyzed activation ...
Homo sapiens
Characterization and functiona ...
Homo sapiens
Invest. Ophthalmol. Vis. Sci.
Full and partial deuterium sol ...
Homo sapiens
J. Am. Chem. Soc.
Exosite-interactive regions in ...
Homo sapiens
J. Biol. Chem.
Crystal structure of thrombin ...
Homo sapiens
J. Biol. Chem.
Chemically modified thrombin a ...
Homo sapiens
J. Thromb. Haemost.
Residue Asp-189 controls both ...
Homo sapiens
J. Biol. Chem.
De Cristofaro
A natural prothrombin mutant r ...
Homo sapiens
J. Biol. Chem.
Thrombin activity is unaltered ...
Bos taurus
Allosteric changes in solvent ...
Bos taurus, Homo sapiens
Temperature dependence of the ...
Homo sapiens
Biophys. Chem.
Crystal structure of the throm ...
Homo sapiens
Biophys. Chem.
Aspartame and aspartame deriva ...
Homo sapiens
Biophys. Chem.
Preparation of recombinant alp ...
Homo sapiens
J. Biochem.
Crystal structure of anticoagu ...
Homo sapiens
J. Biol. Chem.
The anticoagulant thrombin mut ...
Homo sapiens
J. Biol. Chem.
Cleavage of prothrombin bound ...
Homo sapiens
J. Physiol. Pharmacol.
De Cristofaro
Interaction of the 268-282 reg ...
Homo sapiens
Biochem. J.
Cloning, purification and bioc ...
Homo sapiens
J. Chromatogr. B
De Cristofaro
Thrombin domains: structure, f ...
Homo sapiens
J. Thromb. Thrombolysis
A novel approach to thrombin i ...
Homo sapiens
Thromb. Res.
109 Suppl 1
A thermodynamic characterizati ...
Homo sapiens
Anal. Biochem.
Structural requirements for th ...
Homo sapiens
Thrombin inhibition by novel b ...
Homo sapiens
J. Med. Chem.
Substitution of Gly-548 to Ala ...
Homo sapiens
Thromb. Haemost.
de Bosch
Inhibition of thrombin generat ...
Homo sapiens
Thromb. Haemost.
Purification of salmon thrombi ...
Homo sapiens, Salmo salar
Thromb. Res.
Inhibition of human alpha-thro ...
Homo sapiens
J. Mol. Biol.
Factorising ligand affinity: a ...
Bos taurus, Homo sapiens
J. Mol. Biol.
The amino acid sequence in fib ...
Homo sapiens
Thromb. Haemost.
Selective and sustained inhibi ...
Bos taurus, Homo sapiens
Thromb. Haemost.
Inactivation of thrombin by a ...
Homo sapiens
Thromb. Res.
Structure of human alpha-throm ...
Homo sapiens
Acta Crystallogr. Sect. D
Inhibition of thrombin by sulf ...
Homo sapiens
Biochim. Biophys. Acta
Biochemical characterization o ...
Homo sapiens
Thrombin is a potent inducer o ...
Homo sapiens
J. Biol. Chem.
Interaction of the factor XIII ...
Homo sapiens
J. Biol. Chem.
Synthesis of positional-scanni ...
Homo sapiens
Nat. Biotechnol.
Thrombin inhibition by HCII in ...
Homo sapiens
Thromb. Res.
Crystal structures of thombin ...
Homo sapiens
Characterization of the initia ...
Homo sapiens
J. Biol. Chem.
Stable expression and purifica ...
Homo sapiens
Protein Expr. Purif.
Protein engineering thrombin f ...
Homo sapiens
Enzyme flexibility, solvent an ...
Homo sapiens
Conversion of thrombin into an ...
Homo sapiens
Kinetic and crystallographic s ...
Homo sapiens
Crystallographic structure of ...
Homo sapiens
J. Biol. Chem.
Refined 2.3 A X-ray crystal st ...
Bos taurus
J. Mol. Biol.
Dual regulation of cyclic AMP ...
Homo sapiens
Biochem. J.
Characterization of the kineti ...
Homo sapiens
Enzymic and nonenzymic propert ...
Homo sapiens
J. Biol. Chem.
Catalytic properties of bovine ...
Bos taurus
Biochim. Biophys. Acta
Human thrombins. Group IA and ...
Homo sapiens
J. Biol. Chem.
Human thrombins. Production, e ...
Homo sapiens
J. Biol. Chem.
Human thrombin: partial primar ...
Homo sapiens
Arch. Biochem. Biophys.
Thrombin ...
Bos taurus, Equus caballus, Homo sapiens, Sus scrofa
Methods Enzymol.
Isolation and characterization ...
Bos taurus
Biochem. J.
Preparation and partial charac ...
Bos taurus
Biochem. Biophys. Res. Commun.
Two forms of human thrombin. I ...
Homo sapiens
J. Biol. Chem.
Specificity of thrombin. I. Es ...
Homo sapiens
Arch. Biochem. Biophys.