Any feedback?
Please rate this page
(literature.php)
(0/150)

BRENDA support

Literature summary for 3.1.26.3 extracted from

  • Hussain, M.; Abraham, A.M.; Asgari, S.
    An Ascovirus-encoded RNase III autoregulates its expression and suppresses RNA interference-mediated gene silencing (2010), J. Virol., 84, 3624-3630.
    View publication on PubMedView publication on EuropePMC

Cloned(Commentary)

Cloned (Comment) Organism
orf27, virus RNase III phylogenetic analysis Heliothis virescens ascovirus 3e

Organism

Organism UniProt Comment Textmining
Heliothis virescens ascovirus 3e
-
HvAV-3e
-

Source Tissue

Source Tissue Comment Organism Textmining
additional information HvAV-3e-infected HzFB cells Heliothis virescens ascovirus 3e
-

Substrates and Products (Substrate)

Substrates Comment Substrates Organism Products Comment (Products) Rev. Reac.
additional information substrate is dsRNA specific to the HvAV-3e Bro11 and GFP genes. For small RNA cleavage, siRNA duplexes 21 nucleotides in length is used. The sequences of the oligonucleotides are the siRNA duplex-25 GUCCGGAUACUCUUUGCGGAC and siRNA duplex-11 GGAGGAAGAAAGGAGAAAGGA Heliothis virescens ascovirus 3e ?
-
?

Synonyms

Synonyms Comment Organism
RNase III
-
Heliothis virescens ascovirus 3e

Temperature Optimum [°C]

Temperature Optimum [°C] Temperature Optimum Maximum [°C] Comment Organism
37
-
assay at Heliothis virescens ascovirus 3e

pH Optimum

pH Optimum Minimum pH Optimum Maximum Comment Organism
7.5 8 assay at Heliothis virescens ascovirus 3e

Expression

Organism Comment Expression
Heliothis virescens ascovirus 3e the Ascovirus-encoded RNase III autoregulates its expression and suppresses RNA interference-mediated gene silencing additional information

General Information

General Information Comment Organism
additional information orf27 encodes an RNase III-like protein after infection and demonstrates dsRNA specific endoribonuclease activity of the encoded protein. The Ascovirus-encoded RNase III autoregulates its expression and suppresses RNA interference-mediated gene silencing Heliothis virescens ascovirus 3e
physiological function HvAV-3e RNase III is essential for virus DNA replication and infection using RNA interference-mediated gene silencing. RNase III is essential for virus pathology and DNA replication Heliothis virescens ascovirus 3e