Cloned (Comment) | Organism |
---|---|
orf27, virus RNase III phylogenetic analysis | Heliothis virescens ascovirus 3e |
Organism | UniProt | Comment | Textmining |
---|---|---|---|
Heliothis virescens ascovirus 3e | - |
HvAV-3e | - |
Source Tissue | Comment | Organism | Textmining |
---|---|---|---|
additional information | HvAV-3e-infected HzFB cells | Heliothis virescens ascovirus 3e | - |
Substrates | Comment Substrates | Organism | Products | Comment (Products) | Rev. | Reac. |
---|---|---|---|---|---|---|
additional information | substrate is dsRNA specific to the HvAV-3e Bro11 and GFP genes. For small RNA cleavage, siRNA duplexes 21 nucleotides in length is used. The sequences of the oligonucleotides are the siRNA duplex-25 GUCCGGAUACUCUUUGCGGAC and siRNA duplex-11 GGAGGAAGAAAGGAGAAAGGA | Heliothis virescens ascovirus 3e | ? | - |
? |
Synonyms | Comment | Organism |
---|---|---|
RNase III | - |
Heliothis virescens ascovirus 3e |
Temperature Optimum [°C] | Temperature Optimum Maximum [°C] | Comment | Organism |
---|---|---|---|
37 | - |
assay at | Heliothis virescens ascovirus 3e |
pH Optimum Minimum | pH Optimum Maximum | Comment | Organism |
---|---|---|---|
7.5 | 8 | assay at | Heliothis virescens ascovirus 3e |
Organism | Comment | Expression |
---|---|---|
Heliothis virescens ascovirus 3e | the Ascovirus-encoded RNase III autoregulates its expression and suppresses RNA interference-mediated gene silencing | additional information |
General Information | Comment | Organism |
---|---|---|
additional information | orf27 encodes an RNase III-like protein after infection and demonstrates dsRNA specific endoribonuclease activity of the encoded protein. The Ascovirus-encoded RNase III autoregulates its expression and suppresses RNA interference-mediated gene silencing | Heliothis virescens ascovirus 3e |
physiological function | HvAV-3e RNase III is essential for virus DNA replication and infection using RNA interference-mediated gene silencing. RNase III is essential for virus pathology and DNA replication | Heliothis virescens ascovirus 3e |