Inhibitors | Comment | Organism | Structure |
---|---|---|---|
d(GATCATTACTAGGCAGGTGG) | 3'20-merChio | Escherichia coli | |
d(GATCATTACTAGGCTGGTGG) | 3'20-merChi+ | Escherichia coli | |
d(GATTAGGCaGGTGG) | 3'14-merChio | Escherichia coli | |
d(GATTAGGCTGGTGG) | 3'14-merChi+ | Escherichia coli | |
d(GCAGGTGG) | 8-merChio | Escherichia coli | |
d(GCAGGTGGGATCATTACTAG) | 5'20-merChio | Escherichia coli | |
d(GCAGGTGGGATTAG) | 5'14-merChio | Escherichia coli | |
d(GCTGGTGG) | 8-merChi+ | Escherichia coli | |
d(GCTGGTGGGATCATTACTAG) | 5'20-merChi+ | Escherichia coli | |
d(GCTGGTGGgattag) | 5'14-merChi+ | Escherichia coli | |
d(TACTAGGCaGGTGGGATCAT) | 20-merChio | Escherichia coli | |
d(TACTAGGCTGGTGGGATCAT) | 20-merChi+ | Escherichia coli | |
d(TAGGCaGGTGGGAT) | 14-merChio | Escherichia coli | |
d(TAGGCTGGTGGGAT) | 14-merChi+ | Escherichia coli | |
additional information | The overall inhibition is length dependent, the longer the oligonucleotide the more effective the inhibition. The oligonucleotide Chi+ oligonucletides inhibit the activities of enzyme much more than do the oligonucleotides Chi0. | Escherichia coli |
Organism | UniProt | Comment | Textmining |
---|---|---|---|
Escherichia coli | - |
- |
- |
Reaction | Comment | Organism | Reaction ID |
---|---|---|---|
Exonucleolytic cleavage (in the presence of ATP) in either 5'- to 3'- or 3'- to 5'-direction to yield 5'-phosphooligonucleotides | The enzyme generates 3 single-stranded DNA ends used by RecA for homologous recombination. The exonuclease activity is altered when the enzyme encounters a Chi sequence, 5-GCTGGTGG-3, in double-stranded DNA, an event critical to generation of 3 single-stranded DNA. Chi recognition requires that Chi be flanked by DNA at either end. A specific site for Chi recognition exists on enzyme, which binds Chi with greater affinity than a non-Chi sequence and is probably adjacent to non-specific DNA binding sites. | Escherichia coli |
Substrates | Comment Substrates | Organism | Products | Comment (Products) | Rev. | Reac. |
---|---|---|---|---|---|---|
double-stranded DNA | the enzyme is a ATP dependent helicase and exonuclease | Escherichia coli | 3'-ended stretch of single-stranded DNA | - |
? |